Morpholino

MO1-gpr22a

ID

ZDB-MRPHLNO-150129-2

Name

MO1-gpr22a

Previous Names

None

Target

gpr22a (1)

Sequence

5' - TCCCCTCCCTTGTGTTCCCTGTCCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-gpr22a

No data available

Phenotype

Phenotype resulting from MO1-gpr22a

Phenotype	Fish	Figures
caudal fin curved ventral, abnormal	WT + MO1-gpr22a + MO4-tp53	Fig. 1 from Verleyen et al., 2014
determination of digestive tract left/right asymmetry process quality, abnormal	WT + MO1-gpr22a + MO4-tp53	Fig. 2 from Verleyen et al., 2014
determination of left/right asymmetry in lateral mesoderm process quality, abnormal	WT + MO1-gpr22a + MO4-tp53	Fig. 2 , Fig. 3 from Verleyen et al., 2014
determination of liver left/right asymmetry process quality, abnormal	WT + MO1-gpr22a + MO4-tp53	Fig. 2 from Verleyen et al., 2014
heart edematous, abnormal	WT + MO1-gpr22a + MO4-tp53	Fig. 1 from Verleyen et al., 2014
heart looping process quality, abnormal	twu34Tg + MO1-gpr22a + MO4-tp53	Fig. 2 from Verleyen et al., 2014
inner ear has extra parts of type otolith, abnormal	WT + MO1-gpr22a + MO4-tp53	Fig. S6 from Verleyen et al., 2014
Kupffer's vesicle cilium decreased length, abnormal	WT + MO1-gpr22a + MO4-tp53	Fig. 5 from Verleyen et al., 2014
Kupffer's vesicle cilium disorganized, abnormal	WT + MO1-gpr22a + MO4-tp53	Fig. 5 from Verleyen et al., 2014
Kupffer's vesicle cilium has fewer parts of type Kupffer's vesicle axonemal microtubule, abnormal	WT + MO1-gpr22a + MO4-tp53	Fig. 5 from Verleyen et al., 2014
left/right axis specification process quality, abnormal	WT + MO1-gpr22a + MO4-tp53	Fig. 2 from Verleyen et al., 2014
otolith fused with otolith, abnormal	WT + MO1-gpr22a + MO4-tp53	Fig. S6 from Verleyen et al., 2014
whole organism decreased length, abnormal	WT + MO1-gpr22a + MO4-tp53	Fig. 1 from Verleyen et al., 2014

Phenotype of all Fish created by or utilizing MO1-gpr22a

Phenotype	Fish	Conditions	Figures
determination of digestive tract left/right asymmetry process quality, abnormal	WT + MO1-gpr22a + MO4-tp53	standard conditions	Fig. 2 from Verleyen et al., 2014
inner ear has extra parts of type otolith, abnormal	WT + MO1-gpr22a + MO4-tp53	standard conditions	Fig. S6 from Verleyen et al., 2014
heart edematous, abnormal	WT + MO1-gpr22a + MO4-tp53	standard conditions	Fig. 1 from Verleyen et al., 2014
Kupffer's vesicle cilium decreased length, abnormal	WT + MO1-gpr22a + MO4-tp53	standard conditions	Fig. 5 from Verleyen et al., 2014
otolith fused with otolith, abnormal	WT + MO1-gpr22a + MO4-tp53	standard conditions	Fig. S6 from Verleyen et al., 2014
Kupffer's vesicle cilium disorganized, abnormal	WT + MO1-gpr22a + MO4-tp53	standard conditions	Fig. 5 from Verleyen et al., 2014
determination of liver left/right asymmetry process quality, abnormal	WT + MO1-gpr22a + MO4-tp53	standard conditions	Fig. 2 from Verleyen et al., 2014
left/right axis specification process quality, abnormal	WT + MO1-gpr22a + MO4-tp53	standard conditions	Fig. 2 from Verleyen et al., 2014
Kupffer's vesicle cilium has fewer parts of type Kupffer's vesicle axonemal microtubule, abnormal	WT + MO1-gpr22a + MO4-tp53	standard conditions	Fig. 5 from Verleyen et al., 2014
caudal fin curved ventral, abnormal	WT + MO1-gpr22a + MO4-tp53	standard conditions	Fig. 1 from Verleyen et al., 2014
whole organism decreased length, abnormal	WT + MO1-gpr22a + MO4-tp53	standard conditions	Fig. 1 from Verleyen et al., 2014
determination of left/right asymmetry in lateral mesoderm process quality, abnormal	WT + MO1-gpr22a + MO4-tp53	standard conditions	Fig. 2 , Fig. 3 from Verleyen et al., 2014
heart looping process quality, abnormal	twu34Tg + MO1-gpr22a + MO4-tp53	standard conditions	Fig. 2 from Verleyen et al., 2014
left/right axis specification process quality, abnormal	twu34Tg + MO1-gpr22a + MO4-tp53	standard conditions	Fig. 2 from Verleyen et al., 2014

Citations