ZFIN ID: ZDB-MRPHLNO-150129-2
Morpholino Name: MO1-gpr22a
Target: gpr22a (1)
Sequence:
5' - TCCCCTCCCTTGTGTTCCCTGTCCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-gpr22a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-gpr22a No data available
PHENOTYPE
Phenotype resulting from MO1-gpr22a
Phenotype of all Fish created by or utilizing MO1-gpr22a
Phenotype Fish Conditions Figures
determination of digestive tract left/right asymmetry process quality, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 2 with image from Verleyen et al., 2014
inner ear has extra parts of type otolith, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. S6 with image from Verleyen et al., 2014
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 5 with image from Verleyen et al., 2014
heart edematous, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 1 with image from Verleyen et al., 2014
Kupffer's vesicle cilium disorganized, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 5 with image from Verleyen et al., 2014
otolith fused with otolith, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. S6 with image from Verleyen et al., 2014
determination of liver left/right asymmetry process quality, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 2 with image from Verleyen et al., 2014
left/right axis specification process quality, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 2 with image from Verleyen et al., 2014
Kupffer's vesicle cilium has fewer parts of type Kupffer's vesicle axonemal microtubule, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 5 with image from Verleyen et al., 2014
caudal fin curved ventral, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 1 with image from Verleyen et al., 2014
whole organism decreased length, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 1 with image from Verleyen et al., 2014
determination of left/right asymmetry in lateral mesoderm process quality, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 2 with imageFig. 3 with image from Verleyen et al., 2014
heart looping process quality, abnormal twu34Tg + MO1-gpr22a + MO4-tp53 standard conditions Fig. 2 with image from Verleyen et al., 2014
left/right axis specification process quality, abnormal twu34Tg + MO1-gpr22a + MO4-tp53 standard conditions Fig. 2 with image from Verleyen et al., 2014
Genome Resources:
CITATIONS (1)