header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-150128-1
Morpholino Name: MO5-smoc2
Target: smoc2 (1)
Sequence:
5' - CGCATCCTCGCAGCTCCCCAGAAGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-smoc2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-smoc2 No data available
PHENOTYPE
Phenotype resulting from MO5-smoc2
Phenotype of all Fish created by or utilizing MO5-smoc2
Genome Resources:
CITATIONS (1)