Morpholino
MO1-myo5b
- ID
- ZDB-MRPHLNO-141231-1
- Name
- MO1-myo5b
- Previous Names
- None
- Target
- Sequence
-
5' - GATCTTCTATTACTGACCGAGTTGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-myo5b
Expressed Gene | Anatomy | Figures |
---|---|---|
cdh1 |
Fig 3 ![]() ![]() |
|
cldn7b |
Fig 3 ![]() |
|
cldne |
Fig 3 ![]() |
|
dsc2l |
Fig 3 ![]() |
|
grhl3 |
Fig 3 ![]() |
1 - 5 of 8 Show all
Phenotype
Phenotype resulting from MO1-myo5b
1 - 5 of 32 Show all
Phenotype of all Fish created by or utilizing MO1-myo5b
1 - 5 of 50 Show all
Citations
- Gupta, K., Mukherjee, S., Sen, S., Sonawane, M. (2022) Coordinated activities of Myosin Vb isoforms and mTOR signaling regulate epithelial cell morphology during development. Development (Cambridge, England). 149(6)
- Phatak, M., Kulkarni, S., Miles, L.B., Anjum, N., Dworkin, S., Sonawane, M. (2021) Grhl3 promotes retention of epidermal cells under endocytic stress to maintain epidermal architecture in zebrafish. PLoS Genetics. 17:e1009823
- Sonal, ., Sidhaye, J., Phatak, M., Banerjee, S., Mulay, A., Deshpande, O., Bhide, S., Jacob, T., Gehring, I., Nuesslein-Volhard, C., Sonawane, M. (2014) Myosin Vb Mediated Plasma Membrane Homeostasis Regulates Peridermal Cell Size and Maintains Tissue Homeostasis in the Zebrafish Epidermis. PLoS Genetics. 10:e1004614
1 - 3 of 3
Show