Morpholino

MO1-myo5b

ID
ZDB-MRPHLNO-141231-1
Name
MO1-myo5b
Previous Names
None
Target
Sequence
5' - GATCTTCTATTACTGACCGAGTTGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-myo5b
Phenotype
Phenotype resulting from MO1-myo5b
Phenotype Fish Figures
cell endosome increased accumulation periderm, abnormal zf106Tg + MO1-myo5b Fig. 2 with image from Sonal et al., 2014
cell lysosome increased accumulation periderm, abnormal zf106Tg + MO1-myo5b Fig. 2 with image from Sonal et al., 2014
cell vesicle increased accumulation periderm, abnormal zf106Tg + MO1-myo5b Fig. 2 with image from Sonal et al., 2014
epidermal basal stratum cell population proliferation increased occurrence, abnormal WT + MO1-myo5b Fig. 5 with image from Sonal et al., 2014
epidermal cell ab2-cdh1 labeling increased amount, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 7 with image from Phatak et al., 2021
epidermal cell cdh1 expression increased amount, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 7 with image from Phatak et al., 2021
epidermal cell ab1-llgl2 labeling increased amount, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 6 with image from Phatak et al., 2021
epidermal cell increased thickness, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 6 with image from Phatak et al., 2021
epidermal cell irregular spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 6 with image from Phatak et al., 2021
epidermal cell ab2-cdh1 labeling spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 7 with image from Phatak et al., 2021
epidermal cell cdh1 expression spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 7 with image from Phatak et al., 2021
epidermal cell ab1-llgl2 labeling spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 6 with image from Phatak et al., 2021
epidermal cell delamination cellular spatiotemporal quality, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 7 with image from Phatak et al., 2021
epidermal cell delamination increased frequency, abnormal TU + MO1-myo5b Fig 4 with imageFig 5 with image from Phatak et al., 2021
epidermal cell membrane ab1-llgl2 labeling spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 6 with image from Phatak et al., 2021
epidermis dsc2l expression increased amount, abnormal TU + MO1-myo5b Fig 3 with image from Phatak et al., 2021
epidermis cldne expression increased amount, abnormal TU + MO1-myo5b Fig 3 with image from Phatak et al., 2021
epidermis oclna expression increased amount, abnormal TU + MO1-myo5b Fig 3 with image from Phatak et al., 2021
epidermis cldn7b expression increased amount, abnormal TU + MO1-myo5b Fig 3 with image from Phatak et al., 2021
epidermis cdh1 expression increased amount, abnormal TU + MO1-myo5b Fig 3 with image from Phatak et al., 2021
epidermis grhl3 expression increased amount, abnormal TU + MO1-myo5b Fig 3 with image from Phatak et al., 2021
periderm cell population proliferation increased occurrence, abnormal WT + MO1-myo5b Fig. 5 with image from Sonal et al., 2014
peridermal cell decreased size, abnormal zf106Tg + MO1-myo5b Fig. 4 with imageFig. 5 with image from Sonal et al., 2014
peridermal cell increased amount, abnormal WT + MO1-myo5b Fig. 5 with image from Sonal et al., 2014
peridermal cell apical plasma membrane decreased area, abnormal zf106Tg + MO1-myo5b Fig. 4 with image from Sonal et al., 2014
peridermal cell basolateral plasma membrane decreased area, abnormal zf106Tg + MO1-myo5b Fig. 4 with image from Sonal et al., 2014
peridermal cell cell projection membrane absent, abnormal zf106Tg + MO1-myo5b Fig. 4 with image from Sonal et al., 2014
peridermal cell delamination increased frequency, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 1 with image from Phatak et al., 2021
peridermal cell epithelial structure maintenance decreased process quality, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 1 with image from Phatak et al., 2021
peridermal cell organelle membrane EGFP expression spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 1 with imageFig 4 with image from Phatak et al., 2021
peridermal cell plasma membrane EGFP expression spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 1 with imageFig 4 with image from Phatak et al., 2021
peridermal cell regulation of cell adhesion process quality, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 1 with image from Phatak et al., 2021
Phenotype of all Fish created by or utilizing MO1-myo5b
Phenotype Fish Conditions Figures
epidermal cell membrane ab1-llgl2 labeling spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell irregular spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell cdh1 expression increased amount, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 7 with image from Phatak et al., 2021
epidermal cell cdh1 expression spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 7 with image from Phatak et al., 2021
peridermal cell organelle membrane EGFP expression spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 1 with imageFig 4 with image from Phatak et al., 2021
epidermal cell ab2-cdh1 labeling spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 7 with image from Phatak et al., 2021
peridermal cell regulation of cell adhesion process quality, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 1 with image from Phatak et al., 2021
epidermal cell ab1-llgl2 labeling spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 6 with image from Phatak et al., 2021
peridermal cell delamination increased frequency, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 1 with image from Phatak et al., 2021
epidermal cell ab1-llgl2 labeling increased amount, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell delamination cellular spatiotemporal quality, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 7 with image from Phatak et al., 2021
epidermal cell ab2-cdh1 labeling increased amount, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 7 with image from Phatak et al., 2021
peridermal cell epithelial structure maintenance decreased process quality, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 1 with image from Phatak et al., 2021
epidermal cell increased thickness, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 6 with image from Phatak et al., 2021
peridermal cell plasma membrane EGFP expression spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 1 with imageFig 4 with image from Phatak et al., 2021
epidermis cdh1 expression increased amount, abnormal TU + MO1-myo5b standard conditions Fig 3 with image from Phatak et al., 2021
epidermal cell delamination increased frequency, abnormal TU + MO1-myo5b standard conditions Fig 4 with imageFig 5 with image from Phatak et al., 2021
epidermis cldne expression increased amount, abnormal TU + MO1-myo5b standard conditions Fig 3 with image from Phatak et al., 2021
epidermis cldn7b expression increased amount, abnormal TU + MO1-myo5b standard conditions Fig 3 with image from Phatak et al., 2021
epidermis grhl3 expression increased amount, abnormal TU + MO1-myo5b standard conditions Fig 3 with image from Phatak et al., 2021
epidermis dsc2l expression increased amount, abnormal TU + MO1-myo5b standard conditions Fig 3 with image from Phatak et al., 2021
epidermis oclna expression increased amount, abnormal TU + MO1-myo5b standard conditions Fig 3 with image from Phatak et al., 2021
periderm cell population proliferation increased occurrence, abnormal WT + MO1-myo5b standard conditions Fig. 5 with image from Sonal et al., 2014
epidermal basal stratum cell population proliferation increased occurrence, abnormal WT + MO1-myo5b standard conditions Fig. 5 with image from Sonal et al., 2014
peridermal cell increased amount, abnormal WT + MO1-myo5b standard conditions Fig. 5 with image from Sonal et al., 2014
cell lysosome increased accumulation periderm, abnormal zf106Tg + MO1-myo5b standard conditions Fig. 2 with image from Sonal et al., 2014
peridermal cell apical plasma membrane decreased area, abnormal zf106Tg + MO1-myo5b standard conditions Fig. 4 with image from Sonal et al., 2014
peridermal cell decreased size, abnormal zf106Tg + MO1-myo5b standard conditions Fig. 4 with imageFig. 5 with image from Sonal et al., 2014
cell vesicle increased accumulation periderm, abnormal zf106Tg + MO1-myo5b standard conditions Fig. 2 with image from Sonal et al., 2014
peridermal cell cell projection membrane absent, abnormal zf106Tg + MO1-myo5b standard conditions Fig. 4 with image from Sonal et al., 2014
cell endosome increased accumulation periderm, abnormal zf106Tg + MO1-myo5b standard conditions Fig. 2 with image from Sonal et al., 2014
peridermal cell basolateral plasma membrane decreased area, abnormal zf106Tg + MO1-myo5b standard conditions Fig. 4 with image from Sonal et al., 2014
epidermal cell delamination normal frequency, ameliorated grhl3zf3707/zf3707 + MO1-myo5b standard conditions Fig 4 with image from Phatak et al., 2021
epidermal cell delamination cellular spatiotemporal quality, abnormal zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 7 with image from Phatak et al., 2021
peridermal cell organelle membrane EGFP expression spatial pattern, ameliorated zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 4 with image from Phatak et al., 2021
epidermal cell membrane ab1-llgl2 labeling spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell decreased thickness, abnormal zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell ab1-llgl2 labeling spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell ab2-cdh1 labeling spatial pattern, ameliorated zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 7 with image from Phatak et al., 2021
epidermal cell ab1-llgl2 labeling increased amount, abnormal zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell cell division increased frequency, abnormal zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
peridermal cell plasma membrane EGFP expression spatial pattern, ameliorated zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 4 with image from Phatak et al., 2021
epidermal cell irregular spatial pattern, exacerbated zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell ab2-cdh1 labeling amount, ameliorated zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 7 with image from Phatak et al., 2021
epidermal cell cdh1 expression amount, ameliorated zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 7 with image from Phatak et al., 2021
epidermal cell cdh1 expression spatial pattern, ameliorated zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 7 with image from Phatak et al., 2021
epidermal cell delamination normal frequency, ameliorated TU + MO1-myo5b + MO4-grhl3 standard conditions Fig 4 with image from Phatak et al., 2021
epidermal cell delamination increased frequency, exacerbated TU + MO1-myo5b + MO4-grhl3 standard conditions Fig 5 with image from Phatak et al., 2021
periderm cell decreased amount, abnormal WT + MO1-myo5b + MO2-tp63 standard conditions Fig. 5 with image from Sonal et al., 2014
peridermal cell apoptotic process increased occurrence, abnormal WT + MO1-myo5b + MO2-tp63 standard conditions Fig. 5 with image from Sonal et al., 2014
Citations