ZFIN ID: ZDB-MRPHLNO-140924-3
Morpholino Name: MO4-stab2
Target: stab2 (1)
Sequence:
5' - GAGCCAGAAAGAAGAAACTGAAAGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO. Targets the 5'UTR.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-stab2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-stab2 No data available
PHENOTYPE
Phenotype resulting from MO4-stab2
Phenotype of all Fish created by or utilizing MO4-stab2
Genome Resources:
CITATIONS (1)