Morpholino

MO5-appb

ID
ZDB-MRPHLNO-131025-3
Name
MO5-appb
Previous Names
None
Target
Sequence
5' - CTCTTTTCTCTCTCATTACCTCTTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-appb
Phenotype
Phenotype resulting from MO5-appb
Phenotype Fish Figures
hindbrain neurog1 expression decreased amount, abnormal WT + MO5-appb Fig. 4 with image from Banote et al., 2016
hindbrain dld expression decreased amount, abnormal WT + MO5-appb Fig. 4 with image from Banote et al., 2016
hindbrain dla expression decreased amount, abnormal WT + MO5-appb Fig. 4 with image from Banote et al., 2016
hindbrain notch1a expression increased amount, abnormal WT + MO5-appb Fig. 5 with image from Banote et al., 2016
hindbrain her6 expression increased amount, abnormal WT + MO5-appb Fig. 5 with image from Banote et al., 2016
hindbrain lacks parts or has fewer parts of type Mauthner neuron, abnormal WT + MO5-appb Fig. 2 with imageFig. 7 with image from Banote et al., 2016
hindbrain cell proliferation in hindbrain decreased occurrence, abnormal WT + MO5-appb Fig. 6 with image from Banote et al., 2016
hindbrain neuron differentiation decreased occurrence, abnormal WT + MO5-appb Fig. 2 with imageFig. 4 with image from Banote et al., 2016
hindbrain Notch signaling pathway increased occurrence, abnormal WT + MO5-appb Fig. 5 with image from Banote et al., 2016
larval locomotory behavior increased rate, abnormal AB + MO5-appb Fig. 3 with image from Abramsson et al., 2013
notochord undulate, abnormal AB + MO5-appb Fig. 1 with image from Abramsson et al., 2013
notochord cell circular, abnormal AB + MO5-appb Fig. 1 with image from Abramsson et al., 2013
primary motor neuron axon increased branchiness, abnormal AB + MO5-appb Fig. 8 with image from Abramsson et al., 2013
rhombomere 3 decreased length, abnormal WT + MO5-appb Fig. 8 with image from Banote et al., 2016
rhombomere 3 morphogenesis process quality, abnormal WT + MO5-appb Fig. 8 with image from Banote et al., 2016
rhombomere 4 decreased length, abnormal WT + MO5-appb Fig. 8 with image from Banote et al., 2016
rhombomere 4 morphogenesis process quality, abnormal WT + MO5-appb Fig. 8 with image from Banote et al., 2016
secondary motor neuron axon extension decreased process quality, abnormal rw0Tg + MO5-appb(AB) Fig. 6 with image from Abramsson et al., 2013
synapse assembly disrupted, abnormal AB + MO5-appb Fig. 8 with image from Abramsson et al., 2013
thigmotaxis decreased occurrence, abnormal WT + MO5-appb Fig. 3 with image from Banote et al., 2016
Phenotype of all Fish created by or utilizing MO5-appb
Phenotype Fish Conditions Figures
notochord cell circular, abnormal AB + MO5-appb standard conditions Fig. 1 with image from Abramsson et al., 2013
primary motor neuron axon increased branchiness, abnormal AB + MO5-appb standard conditions Fig. 8 with image from Abramsson et al., 2013
notochord undulate, abnormal AB + MO5-appb standard conditions Fig. 1 with image from Abramsson et al., 2013
synapse assembly disrupted, abnormal AB + MO5-appb standard conditions Fig. 8 with image from Abramsson et al., 2013
larval locomotory behavior increased rate, abnormal AB + MO5-appb standard conditions Fig. 3 with image from Abramsson et al., 2013
hindbrain neurog1 expression decreased amount, abnormal WT + MO5-appb standard conditions Fig. 4 with image from Banote et al., 2016
hindbrain her6 expression increased amount, abnormal WT + MO5-appb standard conditions Fig. 5 with image from Banote et al., 2016
hindbrain notch1a expression increased amount, abnormal WT + MO5-appb standard conditions Fig. 5 with image from Banote et al., 2016
hindbrain cell proliferation in hindbrain decreased occurrence, abnormal WT + MO5-appb standard conditions Fig. 6 with image from Banote et al., 2016
hindbrain dld expression decreased amount, abnormal WT + MO5-appb standard conditions Fig. 4 with image from Banote et al., 2016
rhombomere 3 morphogenesis process quality, abnormal WT + MO5-appb standard conditions Fig. 8 with image from Banote et al., 2016
hindbrain Notch signaling pathway increased occurrence, abnormal WT + MO5-appb standard conditions Fig. 5 with image from Banote et al., 2016
hindbrain lacks parts or has fewer parts of type Mauthner neuron, abnormal WT + MO5-appb standard conditions Fig. 2 with imageFig. 7 with image from Banote et al., 2016
hindbrain dla expression decreased amount, abnormal WT + MO5-appb standard conditions Fig. 4 with image from Banote et al., 2016
hindbrain has number of Mauthner neuron, ameliorated WT + MO5-appb chemical treatment by environment: DAPT Fig. 7 with image from Banote et al., 2016
thigmotaxis decreased occurrence, abnormal WT + MO5-appb standard conditions Fig. 3 with image from Banote et al., 2016
hindbrain neuron differentiation decreased occurrence, abnormal WT + MO5-appb control Fig. 2 with imageFig. 4 with image from Banote et al., 2016
rhombomere 3 decreased length, abnormal WT + MO5-appb standard conditions Fig. 8 with image from Banote et al., 2016
rhombomere 4 morphogenesis process quality, abnormal WT + MO5-appb standard conditions Fig. 8 with image from Banote et al., 2016
rhombomere 4 decreased length, abnormal WT + MO5-appb standard conditions Fig. 8 with image from Banote et al., 2016
secondary motor neuron axon extension decreased process quality, abnormal rw0Tg + MO5-appb(AB) standard conditions Fig. 6 with image from Abramsson et al., 2013
hindbrain has number of Mauthner neuron, ameliorated WT + MO3-notch1a + MO4-notch1a + MO5-appb standard conditions Fig. 7 with image from Banote et al., 2016
Citations