Morpholino

MO4-cyp26a1

ID
ZDB-MRPHLNO-131002-1
Name
MO4-cyp26a1
Previous Names
None
Target
Sequence
5' - TCTTATCATCCTTACCTTTTTCTTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-cyp26a1
No data available
Phenotype
Phenotype resulting from MO4-cyp26a1
No data available
Phenotype of all Fish created by or utilizing MO4-cyp26a1
Phenotype Fish Conditions Figures
heart edematous, abnormal WT + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. S2 with image from Rydeen et al., 2014
hindbrain edematous, abnormal WT + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. S2 with image from Rydeen et al., 2014
whole organism mmp9 expression increased amount, abnormal WT + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 5 with image from Rydeen et al., 2016
whole organism fgf8a expression decreased amount, abnormal WT + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 4 with image from Rydeen et al., 2016
heart fgf8a expression decreased amount, abnormal WT + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 4 with image from Rydeen et al., 2016
heart mmp9 expression increased amount, abnormal WT + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 5 with image from Rydeen et al., 2016
hindbrain edematous, abnormal WT + MO1-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. S2 with image from Rydeen et al., 2014
atrium has fewer parts of type cardiac muscle cell, abnormal WT + MO1-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 2 with image from Rydeen et al., 2014
heart edematous, abnormal WT + MO1-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. S2 with image from Rydeen et al., 2014
midbrain hindbrain boundary absent, abnormal WT + MO2-rarab + MO4-cyp26a1 + MO4-tp53 + MO5-cyp26a1 standard conditions Fig. 5 with image,  Fig. 6 with image from D'Aniello et al., 2013
caudal fin shortened, abnormal WT + MO2-rarab + MO4-cyp26a1 + MO4-tp53 + MO5-cyp26a1 standard conditions Fig. 5 with image from D'Aniello et al., 2013
ventricular myocardium cardiac muscle cell mislocalised, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 5 with image from Rydeen et al., 2016
cardiac ventricle has number of cardiac muscle cell, ameliorated f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 chemical treatment by environment: 3-(N-HYDROXYCARBOXAMIDO)-2-ISOBUTYLPROPANOYL-TRP-METHYLAMIDE Fig. 5 with image from Rydeen et al., 2016
whole organism myl7 expression decreased amount, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with image from Rydeen et al., 2016
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 1 with image,  Fig. 5 with image from Rydeen et al., 2016
cardiac ventricle decreased size, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac muscle cell external to heart, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis process quality, ameliorated f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 chemical treatment by environment: 3-(N-HYDROXYCARBOXAMIDO)-2-ISOBUTYLPROPANOYL-TRP-METHYLAMIDE Fig. 5 with image from Rydeen et al., 2016
whole organism myh7 expression decreased amount, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with image from Rydeen et al., 2016
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal f2Tg + MO2-rarab + MO4-cyp26a1 + MO4-tp53 + MO5-cyp26a1 standard conditions Fig. 5 with image from D'Aniello et al., 2013
heart has fewer parts of type cardiac muscle cell, abnormal f2Tg + MO2-rarab + MO4-cyp26a1 + MO4-tp53 + MO5-cyp26a1 standard conditions Fig. 5 with image from D'Aniello et al., 2013
presumptive bulbus arteriosus ripply3 expression increased amount, abnormal fb7Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO4-tp53 + MO5-cyp26a1 standard conditions Fig 7 with image from Song et al., 2019
cell migration involved in heart formation process quality, abnormal fb7Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 2 with image from Rydeen et al., 2016
cardiac ventricle cell migration involved in heart formation decreased process quality, abnormal fb9Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 2 with image from Rydeen et al., 2016
aortic arch has extra parts of type blood vessel endothelial cell, abnormal fb9Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 2 with image from Rydeen et al., 2016
bulbus arteriosus outflow tract morphogenesis decreased process quality, abnormal sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
bulbus arteriosus outflow tract morphogenesis process quality, ameliorated sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 chemical treatment by environment: 3-(N-HYDROXYCARBOXAMIDO)-2-ISOBUTYLPROPANOYL-TRP-METHYLAMIDE Fig. 5 with image from Rydeen et al., 2016
cardiac muscle cell external to heart, abnormal sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with image from Rydeen et al., 2016
cardiac muscle cell mislocalised, abnormal sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with image from Rydeen et al., 2016
bulbus arteriosus outflow tract morphogenesis decreased process quality, abnormal sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with image,  Fig. 5 with image from Rydeen et al., 2016
ventricular myocardium cardiac muscle cell mislocalised, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
cardiac ventricle cardiac muscle cell circular, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
ventricular myocardium cell-cell junction ab1-ctnnb labeling spatial pattern, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
ventricular myocardium bicellular tight junction ab1-tjp1 labeling spatial pattern, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
cardiac ventricle establishment of cell polarity decreased process quality, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
endocardium has fewer parts of type endothelial cell, abnormal ubs1Tg + MO1-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 7 with image from Rydeen et al., 2014
cranial vasculature has fewer parts of type endothelial cell, abnormal ubs1Tg + MO1-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 7 with image from Rydeen et al., 2014
ventricular myocardium increased distance ventricular endocardium, abnormal ci5Tg; twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal ci5Tg; twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
aortic arch 4 has extra parts of type blood vessel endothelial cell, abnormal fb9Tg; ubs1Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 2 with image from Rydeen et al., 2016
cardiac ventricle cell migration involved in heart formation decreased process quality, abnormal fb9Tg; ubs1Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 2 with image from Rydeen et al., 2016
aortic arch 3 has extra parts of type blood vessel endothelial cell, abnormal fb9Tg; ubs1Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 2 with image from Rydeen et al., 2016
ventricular myocardium cardiac muscle cell mislocalised, abnormal f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle has number of cardiac muscle cell, ameliorated f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac muscle cell external to heart, abnormal f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
bulbus arteriosus outflow tract morphogenesis process quality, ameliorated pd3Tg; sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.