Morpholino

MO2-cds2

ID
ZDB-MRPHLNO-130829-1
Name
MO2-cds2
Previous Names
  • cds2-ATG (1)
Target
Sequence
5' - TCGCTGTCGTAATTCTGTCATGGTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cds2
No data available
Phenotype
Phenotype resulting from MO2-cds2
Phenotype of all Fish created by or utilizing MO2-cds2
Phenotype Fish Conditions Figures
trunk ab9-mapk labeling decreased amount, abnormal y1Tg + MO2-cds2 control Fig. S8 from Stratman et al., 2020
intersegmental vessel decreased length, abnormal y1Tg + MO2-cds2 standard conditions Fig. 2Fig. 3Fig. 4 from Pan et al., 2012
whole organism 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate decreased amount, abnormal y1Tg + MO2-cds2 control Fig. 7 with image from Zhao et al., 2019
intersegmental vessel malformed, abnormal y1Tg + MO2-cds2 control Fig. 1 with image from Zhao et al., 2019
angiogenesis disrupted, abnormal y1Tg + MO2-cds2 standard conditions Fig. 2Fig. 3Fig. 4 from Pan et al., 2012
blood vessel endothelial cell decreased amount, abnormal y1Tg + MO2-cds2 standard conditions Fig. 3 from Pan et al., 2012
central artery decreased amount, abnormal y1Tg + MO2-cds2 control Fig. S1 from Stratman et al., 2020
hindbrain sprouting angiogenesis decreased occurrence, abnormal y1Tg + MO2-cds2 control Fig. S1 from Stratman et al., 2020
positive regulation of ERK1 and ERK2 cascade decreased magnitude, abnormal y1Tg + MO2-cds2 standard conditions Fig. 3Fig. 4 from Pan et al., 2012
positive regulation of vascular endothelial growth factor signaling pathway decreased occurrence, abnormal y1Tg + MO2-cds2 standard conditions Fig. 3Fig. 4 from Pan et al., 2012
trunk vasculature malformed, abnormal y1Tg + MO2-cds2 control Fig. 1 with image from Zhao et al., 2019
trunk vasculature malformed, exacerbated y1Tg; zf1092Tg + MO2-cds2 heat shock Fig. 1 with image from Zhao et al., 2019
whole organism 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate decreased amount, abnormal y1Tg; zf1092Tg + MO2-cds2 heat shock Fig. 4 with imageFig. 7 with image from Zhao et al., 2019
whole organism 1-phosphatidyl-1D-myo-inositol 3,4,5-trisphosphate decreased amount, abnormal y1Tg; zf1092Tg + MO2-cds2 heat shock Fig. 4 with imageFig. 7 with image from Zhao et al., 2019
intersegmental vessel malformed, exacerbated y1Tg; zf1092Tg + MO2-cds2 heat shock Fig. 1 with image from Zhao et al., 2019
whole organism 1-phosphatidyl-1D-myo-inositol 3,4,5-trisphosphate decreased amount, ameliorated y1Tg; zf1092Tg + MO2-cds2 + MO4-plcg1 heat shock Fig. 7 with image from Zhao et al., 2019
whole organism 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate decreased amount, ameliorated y1Tg; zf1092Tg + MO2-cds2 + MO4-plcg1 heat shock Fig. 7 with image from Zhao et al., 2019
whole organism 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate decreased amount, abnormal y1Tg; zf1092Tg + MO2-cds2 + MO3-ptena + MO3-ptenb heat shock Fig. 4 with image from Zhao et al., 2019
whole organism 1-phosphatidyl-1D-myo-inositol 3,4,5-trisphosphate decreased amount, ameliorated y1Tg; zf1092Tg + MO2-cds2 + MO3-ptena + MO3-ptenb heat shock Fig. 4 with image from Zhao et al., 2019
Citations