Morpholino

MO2-cds2

ID

ZDB-MRPHLNO-130829-1

Name

MO2-cds2

Previous Names

cds2-ATG (1)

Target

cds2 (1)

Sequence

5' - TCGCTGTCGTAATTCTGTCATGGTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-cds2

Expressed Gene	Anatomy	Figures
dll4	artery	Fig. 3 from Pan et al., 2012
flt4	vein	Fig. 3 from Pan et al., 2012

Phenotype

Phenotype resulting from MO2-cds2

Phenotype	Fish	Figures
angiogenesis disrupted, abnormal	y1Tg + MO2-cds2	Fig. 2, Fig. 3, Fig. 4 from Pan et al., 2012
blood vessel endothelial cell decreased amount, abnormal	y1Tg + MO2-cds2	Fig. 3 from Pan et al., 2012
central artery decreased amount, abnormal	y1Tg + MO2-cds2	Fig. S1 from Stratman et al., 2020
hindbrain sprouting angiogenesis decreased occurrence, abnormal	y1Tg + MO2-cds2	Fig. S1 from Stratman et al., 2020
intersegmental vessel decreased length, abnormal	y1Tg + MO2-cds2	Fig. 2, Fig. 3, Fig. 4 from Pan et al., 2012
intersegmental vessel malformed, abnormal	y1Tg + MO2-cds2	Fig. 1 from Zhao et al., 2019
positive regulation of ERK1 and ERK2 cascade decreased magnitude, abnormal	y1Tg + MO2-cds2	Fig. 3, Fig. 4 from Pan et al., 2012
positive regulation of vascular endothelial growth factor signaling pathway decreased occurrence, abnormal	y1Tg + MO2-cds2	Fig. 3, Fig. 4 from Pan et al., 2012
trunk ab9-mapk labeling decreased amount, abnormal	y1Tg + MO2-cds2	Fig. S8 from Stratman et al., 2020
trunk vasculature malformed, abnormal	y1Tg + MO2-cds2	Fig. 1 from Zhao et al., 2019
whole organism 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate decreased amount, abnormal	y1Tg + MO2-cds2	Fig. 7 from Zhao et al., 2019

Phenotype of all Fish created by or utilizing MO2-cds2

Phenotype	Fish	Conditions	Figures
trunk ab9-mapk labeling decreased amount, abnormal	y1Tg + MO2-cds2	control	Fig. S8 from Stratman et al., 2020
intersegmental vessel decreased length, abnormal	y1Tg + MO2-cds2	standard conditions	Fig. 2, Fig. 3, Fig. 4 from Pan et al., 2012
whole organism 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate decreased amount, abnormal	y1Tg + MO2-cds2	control	Fig. 7 from Zhao et al., 2019
intersegmental vessel malformed, abnormal	y1Tg + MO2-cds2	control	Fig. 1 from Zhao et al., 2019
angiogenesis disrupted, abnormal	y1Tg + MO2-cds2	standard conditions	Fig. 2, Fig. 3, Fig. 4 from Pan et al., 2012
blood vessel endothelial cell decreased amount, abnormal	y1Tg + MO2-cds2	standard conditions	Fig. 3 from Pan et al., 2012
central artery decreased amount, abnormal	y1Tg + MO2-cds2	control	Fig. S1 from Stratman et al., 2020
hindbrain sprouting angiogenesis decreased occurrence, abnormal	y1Tg + MO2-cds2	control	Fig. S1 from Stratman et al., 2020
positive regulation of ERK1 and ERK2 cascade decreased magnitude, abnormal	y1Tg + MO2-cds2	standard conditions	Fig. 3, Fig. 4 from Pan et al., 2012
positive regulation of vascular endothelial growth factor signaling pathway decreased occurrence, abnormal	y1Tg + MO2-cds2	standard conditions	Fig. 3, Fig. 4 from Pan et al., 2012
trunk vasculature malformed, abnormal	y1Tg + MO2-cds2	control	Fig. 1 from Zhao et al., 2019
trunk vasculature malformed, exacerbated	y1Tg; zf1092Tg + MO2-cds2	heat shock	Fig. 1 from Zhao et al., 2019
whole organism 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate decreased amount, abnormal	y1Tg; zf1092Tg + MO2-cds2	heat shock	Fig. 4 , Fig. 7 from Zhao et al., 2019
whole organism 1-phosphatidyl-1D-myo-inositol 3,4,5-trisphosphate decreased amount, abnormal	y1Tg; zf1092Tg + MO2-cds2	heat shock	Fig. 4 , Fig. 7 from Zhao et al., 2019
intersegmental vessel malformed, exacerbated	y1Tg; zf1092Tg + MO2-cds2	heat shock	Fig. 1 from Zhao et al., 2019
whole organism 1-phosphatidyl-1D-myo-inositol 3,4,5-trisphosphate decreased amount, ameliorated	y1Tg; zf1092Tg + MO2-cds2 + MO4-plcg1	heat shock	Fig. 7 from Zhao et al., 2019
whole organism 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate decreased amount, ameliorated	y1Tg; zf1092Tg + MO2-cds2 + MO4-plcg1	heat shock	Fig. 7 from Zhao et al., 2019
whole organism 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate decreased amount, abnormal	y1Tg; zf1092Tg + MO2-cds2 + MO3-ptena + MO3-ptenb	heat shock	Fig. 4 from Zhao et al., 2019
whole organism 1-phosphatidyl-1D-myo-inositol 3,4,5-trisphosphate decreased amount, ameliorated	y1Tg; zf1092Tg + MO2-cds2 + MO3-ptena + MO3-ptenb	heat shock	Fig. 4 from Zhao et al., 2019

Citations