ZFIN ID: ZDB-MRPHLNO-130726-2
Morpholino Name: MO2-kcnj10a
Target: kcnj10a (1)
Sequence:
5' - AATTGTGAGAGCTATACCTTGGCGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-kcnj10a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-kcnj10a No data available
PHENOTYPE
Phenotype resulting from MO2-kcnj10a
Phenotype Figures
locomotory behavior process quality, abnormal Fig. 6 with image from Sicca et al., 2016
pronephric duct dilated, abnormal Fig. 6 with image from Sicca et al., 2016
swim bladder absent, abnormal Fig. 6 with image from Sicca et al., 2016
whole organism increased contractility, abnormal Fig. 1 with imageFig. 2 with image from Zdebik et al., 2013
whole organism movement behavioral quality, abnormal Fig. 2 with image from Zdebik et al., 2013

Phenotype of all Fish created by or utilizing MO2-kcnj10a
Phenotype Fish Conditions Figures
whole organism increased contractility, abnormal TL + MO2-kcnj10a standard conditions Fig. 1 with imageFig. 2 with image from Zdebik et al., 2013
whole organism movement behavioral quality, abnormal TL + MO2-kcnj10a standard conditions Fig. 2 with image from Zdebik et al., 2013
locomotory behavior process quality, abnormal WT + MO2-kcnj10a standard conditions Fig. 6 with image from Sicca et al., 2016
swim bladder absent, abnormal WT + MO2-kcnj10a standard conditions Fig. 6 with image from Sicca et al., 2016
pronephric duct dilated, abnormal WT + MO2-kcnj10a standard conditions Fig. 6 with image from Sicca et al., 2016
OTHER MO2-kcnj10a MORPHOLINO PAGESNo links to external sites
CITATIONS (3)