Morpholino

MO1-zfyve26

ID

ZDB-MRPHLNO-121220-1

Name

MO1-zfyve26

Previous Names

Target

Sequence

5' - GCCGAACGGGTGCATGATCCTCAAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-zfyve26

No data available

Phenotype

Phenotype resulting from MO1-zfyve26

Phenotype	Fish	Figures
eye decreased size, abnormal	AB + MO1-zfyve26	Fig. 2 from Martin et al., 2012
head decreased size, abnormal	AB + MO1-zfyve26	Fig. 2 from Martin et al., 2012
motor neuron axon branchiness, abnormal	zf532Tg + MO1-zfyve26	Fig. 4 from Martin et al., 2012
motor neuron axon truncated, abnormal	zf532Tg + MO1-zfyve26	Fig. 4 from Martin et al., 2012
motor neuron axon guidance process quality, abnormal	zf532Tg + MO1-zfyve26	Fig. 4 from Martin et al., 2012
post-vent region deformed, abnormal	AB + MO1-zfyve26	Fig. 2 from Martin et al., 2012
post-vent region increased curvature, abnormal	AB + MO1-zfyve26	Fig. 2 from Martin et al., 2012
skeletal muscle acetylcholine-gated channel clustering disrupted, abnormal	zf532Tg + MO1-zfyve26	Fig. 4 from Martin et al., 2012
swimming behavior disrupted, abnormal	AB + MO1-zfyve26	Fig. S2 from Martin et al., 2012
thigmotaxis disrupted, abnormal	AB + MO1-zfyve26	Fig. S2 from Martin et al., 2012

Phenotype of all Fish created by or utilizing MO1-zfyve26

Phenotype	Fish	Conditions	Figures
head decreased size, abnormal	AB + MO1-zfyve26	standard conditions	Fig. 2 from Martin et al., 2012
thigmotaxis disrupted, abnormal	AB + MO1-zfyve26	standard conditions	Fig. S2 from Martin et al., 2012
eye decreased size, abnormal	AB + MO1-zfyve26	standard conditions	Fig. 2 from Martin et al., 2012
swimming behavior disrupted, abnormal	AB + MO1-zfyve26	standard conditions	Fig. S2 from Martin et al., 2012
post-vent region increased curvature, abnormal	AB + MO1-zfyve26	standard conditions	Fig. 2 from Martin et al., 2012
post-vent region deformed, abnormal	AB + MO1-zfyve26	standard conditions	Fig. 2 from Martin et al., 2012
motor neuron axon guidance process quality, abnormal	zf532Tg + MO1-zfyve26	standard conditions	Fig. 4 from Martin et al., 2012
motor neuron axon branchiness, abnormal	zf532Tg + MO1-zfyve26	standard conditions	Fig. 4 from Martin et al., 2012
skeletal muscle acetylcholine-gated channel clustering disrupted, abnormal	zf532Tg + MO1-zfyve26	standard conditions	Fig. 4 from Martin et al., 2012
motor neuron axon truncated, abnormal	zf532Tg + MO1-zfyve26	standard conditions	Fig. 4 from Martin et al., 2012

Citations