Morpholino

MO1-tlcd3ba

ID
ZDB-MRPHLNO-121207-6
Name
MO1-tlcd3ba
Previous Names
  • MO1-fam57ba
Target
Sequence
5' - ATGCCTGGAAGGAAAATGGAAGAGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tlcd3ba
No data available
Phenotype
Phenotype resulting from MO1-tlcd3ba
Phenotype Fish Figures
brain morphology, abnormal WT + MO1-tlcd3ba Fig. 2 with image from Blaker-Lee et al., 2012
central nervous system projection neuron axonogenesis disrupted, abnormal WT + MO1-tlcd3ba Fig. 3 with image from Blaker-Lee et al., 2012
eye morphology, abnormal WT + MO1-tlcd3ba Fig. 3 with image from Blaker-Lee et al., 2012
forebrain decreased width, abnormal WT + MO1-tlcd3ba Fig. 2 with image from Blaker-Lee et al., 2012
forebrain axon decreased size, abnormal WT + MO1-tlcd3ba Fig. 5 with image from Blaker-Lee et al., 2012
forebrain axon disorganized, abnormal WT + MO1-tlcd3ba Fig. 5 with image from Blaker-Lee et al., 2012
hindbrain axon decreased length, abnormal WT + MO1-tlcd3ba Fig. 5 with image from Blaker-Lee et al., 2012
hindbrain axon disorganized, abnormal WT + MO1-tlcd3ba Fig. 5 with image from Blaker-Lee et al., 2012
midbrain shape, abnormal WT + MO1-tlcd3ba Fig. 2 with image from Blaker-Lee et al., 2012
pigment cell decreased amount, abnormal WT + MO1-tlcd3ba Fig. S3 with image from Blaker-Lee et al., 2012
somite U-shaped, abnormal WT + MO1-tlcd3ba Fig. 3 with image from Blaker-Lee et al., 2012
thigmotaxis decreased process quality, abnormal WT + MO1-tlcd3ba Fig. 3 with image from Blaker-Lee et al., 2012
whole organism movement quality, abnormal WT + MO1-tlcd3ba Fig. 3 with image from Blaker-Lee et al., 2012
whole organism pigmented, abnormal WT + MO1-tlcd3ba Fig. 3 with image from Blaker-Lee et al., 2012
Phenotype of all Fish created by or utilizing MO1-tlcd3ba
Phenotype Fish Conditions Figures
forebrain axon decreased size, abnormal WT + MO1-tlcd3ba standard conditions Fig. 5 with image from Blaker-Lee et al., 2012
central nervous system projection neuron axonogenesis disrupted, abnormal WT + MO1-tlcd3ba standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
midbrain shape, abnormal WT + MO1-tlcd3ba standard conditions Fig. 2 with image from Blaker-Lee et al., 2012
hindbrain axon decreased length, abnormal WT + MO1-tlcd3ba standard conditions Fig. 5 with image from Blaker-Lee et al., 2012
whole organism movement quality, abnormal WT + MO1-tlcd3ba standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
somite U-shaped, abnormal WT + MO1-tlcd3ba standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
whole organism pigmented, abnormal WT + MO1-tlcd3ba standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
forebrain decreased width, abnormal WT + MO1-tlcd3ba standard conditions Fig. 2 with image from Blaker-Lee et al., 2012
pigment cell decreased amount, abnormal WT + MO1-tlcd3ba standard conditions Fig. S3 with image from Blaker-Lee et al., 2012
eye morphology, abnormal WT + MO1-tlcd3ba standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
forebrain axon disorganized, abnormal WT + MO1-tlcd3ba standard conditions Fig. 5 with image from Blaker-Lee et al., 2012
brain morphology, abnormal WT + MO1-tlcd3ba standard conditions Fig. 2 with image from Blaker-Lee et al., 2012
hindbrain axon disorganized, abnormal WT + MO1-tlcd3ba standard conditions Fig. 5 with image from Blaker-Lee et al., 2012
thigmotaxis decreased process quality, abnormal WT + MO1-tlcd3ba standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
ventricular system morphology, abnormal AB + MO1-aldoaa + MO1-tlcd3ba standard conditions Table S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-aldoaa + MO1-tlcd3ba standard conditions Table S2 from McCammon et al., 2017
whole organism doc2a expression decreased amount, abnormal AB + MO1-doc2a + MO1-tlcd3ba standard conditions Fig. S2 from McCammon et al., 2017
ventricular system morphology, abnormal AB + MO1-doc2a + MO1-tlcd3ba standard conditions Fig. S1 with image,  Table S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-doc2a + MO1-tlcd3ba standard conditions Fig. S1 with image,  Table S2 from McCammon et al., 2017
whole organism tlcd3ba expression decreased amount, abnormal AB + MO1-doc2a + MO1-tlcd3ba standard conditions Fig. S2 from McCammon et al., 2017
ventricular system morphology, abnormal AB + MO1-hirip3 + MO1-tlcd3ba + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-hirip3 + MO1-tlcd3ba + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
ventricular system morphology, abnormal AB + MO1-tlcd3ba + MO2-kctd13 standard conditions Fig. S1 with image,  Table S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-tlcd3ba + MO2-kctd13 standard conditions Fig. S1 with image,  Table S2 from McCammon et al., 2017
central nervous system neuron differentiation process quality, abnormal nl1Tg + MO1-hirip3 + MO1-tlcd3ba + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
cranial nerve development process quality, abnormal rw0Tg + MO1-aldoaa + MO1-tlcd3ba standard conditions Table S2 from McCammon et al., 2017
cranial nerve development process quality, abnormal rw0Tg + MO1-hirip3 + MO1-tlcd3ba + MO4-tp53 standard conditions Fig. S3 with image,  Table S2 from McCammon et al., 2017
cranial nerve V decreased size, abnormal rw0Tg + MO1-hirip3 + MO1-tlcd3ba + MO4-tp53 standard conditions Fig. S3 with image from McCammon et al., 2017
cranial nerve VII shape, abnormal rw0Tg + MO1-hirip3 + MO1-tlcd3ba + MO4-tp53 standard conditions Fig. S3 with image from McCammon et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.