Morpholino

MO1-wnt16

ID

ZDB-MRPHLNO-120329-1

Name

MO1-wnt16

Previous Names

W16MO1 (1)

Target

wnt16 (1)

Sequence

5' - AGGTTAGTTCTGTCACCCACCTGTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-wnt16

No data available

Phenotype

Phenotype resulting from MO1-wnt16

Phenotype	Fish	Figures
embryonic skeletal joint development decreased process quality, abnormal	rk8Tg; sq9Tg + MO1-wnt16	Fig. 4 from Brunt et al., 2017
joint cell migration decreased occurrence, abnormal	rk8Tg; sq9Tg + MO1-wnt16	Fig. 4 from Brunt et al., 2017
joint cell population proliferation decreased occurrence, abnormal	rk8Tg; sq9Tg + MO1-wnt16	Fig. 4 from Brunt et al., 2017
Meckel's cartilage joint morphology, abnormal	hu5910Tg + MO1-wnt16	Fig. 3 from Brunt et al., 2017
palatoquadrate cartilage joint morphology, abnormal	hu5910Tg + MO1-wnt16	Fig. 3 from Brunt et al., 2017
retroarticular cell population proliferation decreased occurrence, abnormal	a131Tg; ba74Tg + MO1-wnt16	Fig. 5 from Brunt et al., 2017

Phenotype of all Fish created by or utilizing MO1-wnt16

Phenotype	Fish	Conditions	Figures
intersegmental vessel spatial pattern, abnormal	WT + MO1-wnt16 + MO2-wnt16	standard conditions	Fig. 2 from Clements et al., 2011
Notch signaling pathway disrupted, abnormal	WT + MO1-wnt16 + MO2-wnt16	standard conditions	Fig. 3 from Clements et al., 2011
hematopoietic stem cell differentiation disrupted, abnormal	WT + MO1-wnt16 + MO2-wnt16	standard conditions	Fig. 1, Fig. 3 from Clements et al., 2011
hematopoietic stem cell absent, abnormal	WT + MO1-wnt16 + MO2-wnt16	standard conditions	Fig. 1 from Clements et al., 2011
trunk altered number of intersegmental vessel, abnormal	WT + MO1-wnt16 + MO2-wnt16	standard conditions	Fig. 2 from Clements et al., 2011
thymus T cell absent, abnormal	WT + MO1-wnt16 + MO2-wnt16	standard conditions	Fig. 1 from Clements et al., 2011
Meckel's cartilage joint morphology, abnormal	hu5910Tg + MO1-wnt16	standard conditions	Fig. 3 from Brunt et al., 2017
palatoquadrate cartilage joint morphology, abnormal	hu5910Tg + MO1-wnt16	standard conditions	Fig. 3 from Brunt et al., 2017
retroarticular cell population proliferation decreased occurrence, abnormal	a131Tg; ba74Tg + MO1-wnt16	standard conditions	Fig. 5 from Brunt et al., 2017
joint cell migration decreased occurrence, abnormal	rk8Tg; sq9Tg + MO1-wnt16	standard conditions	Fig. 4 from Brunt et al., 2017
joint cell population proliferation decreased occurrence, abnormal	rk8Tg; sq9Tg + MO1-wnt16	standard conditions	Fig. 4 from Brunt et al., 2017
embryonic skeletal joint development decreased process quality, abnormal	rk8Tg; sq9Tg + MO1-wnt16	standard conditions	Fig. 4 from Brunt et al., 2017

Citations