Morpholino

MO1-wnt16

ID
ZDB-MRPHLNO-120329-1
Name
MO1-wnt16
Previous Names
  • W16MO1 (1)
Target
Sequence
5' - AGGTTAGTTCTGTCACCCACCTGTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-wnt16
No data available
Phenotype
Phenotype resulting from MO1-wnt16
Phenotype of all Fish created by or utilizing MO1-wnt16
Phenotype Fish Conditions Figures
intersegmental vessel spatial pattern, abnormal WT + MO1-wnt16 + MO2-wnt16 standard conditions Fig. 2 from Clements et al., 2011
Notch signaling pathway disrupted, abnormal WT + MO1-wnt16 + MO2-wnt16 standard conditions Fig. 3 from Clements et al., 2011
hematopoietic stem cell absent, abnormal WT + MO1-wnt16 + MO2-wnt16 standard conditions Fig. 1 from Clements et al., 2011
hematopoietic stem cell differentiation disrupted, abnormal WT + MO1-wnt16 + MO2-wnt16 standard conditions Fig. 1Fig. 3 from Clements et al., 2011
trunk altered number of intersegmental vessel, abnormal WT + MO1-wnt16 + MO2-wnt16 standard conditions Fig. 2 from Clements et al., 2011
thymus T cell absent, abnormal WT + MO1-wnt16 + MO2-wnt16 standard conditions Fig. 1 from Clements et al., 2011
Meckel's cartilage joint morphology, abnormal hu5910Tg + MO1-wnt16 standard conditions Fig. 3 with image from Brunt et al., 2017
palatoquadrate cartilage joint morphology, abnormal hu5910Tg + MO1-wnt16 standard conditions Fig. 3 with image from Brunt et al., 2017
retroarticular cell population proliferation decreased occurrence, abnormal ba74Tg ; a131Tg + MO1-wnt16 standard conditions Fig. 5 with image from Brunt et al., 2017
joint cell migration decreased occurrence, abnormal rk8Tg; sq9Tg + MO1-wnt16 standard conditions Fig. 4 with image from Brunt et al., 2017
joint cell population proliferation decreased occurrence, abnormal rk8Tg; sq9Tg + MO1-wnt16 standard conditions Fig. 4 with image from Brunt et al., 2017
embryonic skeletal joint development decreased process quality, abnormal rk8Tg; sq9Tg + MO1-wnt16 standard conditions Fig. 4 with image from Brunt et al., 2017
Citations