header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-120322-2
Morpholino Name: MO1-popdc2
Target: popdc2 (1)
Sequence:
5' - CTAATCCTGTGAAAGCAGAAGATCC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO. The author provided this corrected sequence.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-popdc2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-popdc2 No data available
PHENOTYPE
Phenotype resulting from MO1-popdc2
Phenotype Figures
cardiac conduction disrupted, abnormal Fig. 8 with imageFig. 9 with image from Kirchmaier et al., 2012
fin musculature disorganized, abnormal Fig. 5 with image from Kirchmaier et al., 2012
heart electrical conductivity, abnormal Fig. 9 with image from Kirchmaier et al., 2012
heart contraction arrhythmic, abnormal Fig. 8 with image from Kirchmaier et al., 2012
heart contraction decreased frequency, abnormal Fig. 8 with image from Kirchmaier et al., 2012
myotome irregular spatial pattern, abnormal Fig. 2 with image from Kirchmaier et al., 2012
myotome U-shaped, abnormal Fig. 2 with imageFig. 4 with image from Kirchmaier et al., 2012
myotome muscle tendon junction decreased thickness, abnormal Fig. 4 with image from Kirchmaier et al., 2012
myotome muscle tendon junction irregular spatial pattern, abnormal Fig. 4 with image from Kirchmaier et al., 2012
myotome muscle tendon junction structure, abnormal Fig. 4 with image from Kirchmaier et al., 2012
myotome myofibril decreased amount, abnormal Fig. 2 with image from Kirchmaier et al., 2012
myotome myofibril distributed, abnormal Fig. 2 with image from Kirchmaier et al., 2012
pericardium edematous, abnormal Fig. 5 with image from Kirchmaier et al., 2012
skeletal muscle cell disorganized, abnormal Fig. 2 with image from Kirchmaier et al., 2012
skeletal muscle fiber development disrupted, abnormal text only from Kirchmaier et al., 2012
trunk musculature disorganized, abnormal Fig. 5 with imagetext only from Kirchmaier et al., 2012
whole organism balance, abnormal text only from Kirchmaier et al., 2012
whole organism circling, abnormal text only from Kirchmaier et al., 2012
whole organism uncoordinated, abnormal text only from Kirchmaier et al., 2012

Phenotype of all Fish created by or utilizing MO1-popdc2
Phenotype Fish Conditions Figures
heart contraction arrhythmic, abnormal WT + MO1-popdc2 standard conditions Fig. 8 with image from Kirchmaier et al., 2012
whole organism circling, abnormal WT + MO1-popdc2 standard conditions text only from Kirchmaier et al., 2012
skeletal muscle cell disorganized, abnormal WT + MO1-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
fin musculature disorganized, abnormal WT + MO1-popdc2 standard conditions Fig. 5 with image from Kirchmaier et al., 2012
whole organism uncoordinated, abnormal WT + MO1-popdc2 standard conditions text only from Kirchmaier et al., 2012
heart contraction decreased frequency, abnormal WT + MO1-popdc2 standard conditions Fig. 8 with image from Kirchmaier et al., 2012
myotome muscle tendon junction structure, abnormal WT + MO1-popdc2 standard conditions Fig. 4 with image from Kirchmaier et al., 2012
cardiac conduction disrupted, abnormal WT + MO1-popdc2 standard conditions Fig. 8 with image from Kirchmaier et al., 2012
whole organism balance, abnormal WT + MO1-popdc2 standard conditions text only from Kirchmaier et al., 2012
skeletal muscle fiber development disrupted, abnormal WT + MO1-popdc2 standard conditions text only from Kirchmaier et al., 2012
trunk musculature disorganized, abnormal WT + MO1-popdc2 standard conditions Fig. 5 with imagetext only from Kirchmaier et al., 2012
myotome U-shaped, abnormal WT + MO1-popdc2 standard conditions Fig. 2 with imageFig. 4 with image from Kirchmaier et al., 2012
myotome muscle tendon junction irregular spatial pattern, abnormal WT + MO1-popdc2 standard conditions Fig. 4 with image from Kirchmaier et al., 2012
myotome muscle tendon junction decreased thickness, abnormal WT + MO1-popdc2 standard conditions Fig. 4 with image from Kirchmaier et al., 2012
pericardium edematous, abnormal WT + MO1-popdc2 standard conditions Fig. 5 with image from Kirchmaier et al., 2012
myotome myofibril distributed, abnormal WT + MO1-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
myotome myofibril decreased amount, abnormal WT + MO1-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
myotome irregular spatial pattern, abnormal WT + MO1-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
atrium orientation cardiac ventricle, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 7 with image from Kirchmaier et al., 2012
skeletal muscle cell disorganized, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
cardiac muscle cell myofibril decreased amount, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 7 with image from Kirchmaier et al., 2012
skeletal muscle cell decreased mass, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 3 with image from Kirchmaier et al., 2012
heart looping process quality, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 7 with image from Kirchmaier et al., 2012
slow muscle cell disorganized, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 3 with image from Kirchmaier et al., 2012
myotome U-shaped, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
fast muscle cell disorganized, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 3 with image from Kirchmaier et al., 2012
slow muscle cell misaligned with slow muscle cell, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 3 with image from Kirchmaier et al., 2012
fast muscle cell variant shape, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 3 with image from Kirchmaier et al., 2012
slow muscle cell undulate, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 3 with image from Kirchmaier et al., 2012
myotome myofibril distributed, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
heart malformed, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 7 with image from Kirchmaier et al., 2012
myotome myofibril decreased amount, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
myotome irregular spatial pattern, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
heart electrical conductivity, abnormal s878Tg + MO1-popdc2 standard conditions Fig. 9 with image from Kirchmaier et al., 2012
cardiac conduction disrupted, abnormal s878Tg + MO1-popdc2 standard conditions Fig. 9 with image from Kirchmaier et al., 2012
cephalic musculature hypoplastic, abnormal zf13Tg + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 6 with image from Kirchmaier et al., 2012
cephalic musculature malformed, abnormal zf13Tg + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 6 with image from Kirchmaier et al., 2012
Genome Resources:
CITATIONS (2)