Morpholino

MO1-pabpc1a

ID
ZDB-MRPHLNO-120222-1
Name
MO1-pabpc1a
Previous Names
None
Target
Sequence
5' - TTCATTTTCACGGCTGGAGGGTTTT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pabpc1a
Expressed Gene Anatomy Figures
cap1 Fig. 5 with image from Yang et al., 2019
tex2 Fig. 5 with image from Yang et al., 2019
tpp2 Fig. 5 with image from Yang et al., 2019
Phenotype
Phenotype resulting from MO1-pabpc1a
Phenotype Fish Figures
embryonic structure tpp2 expression decreased amount, abnormal AB + MO1-pabpc1a Fig. 5 with image from Yang et al., 2019
embryonic structure tex2 expression decreased amount, abnormal AB + MO1-pabpc1a Fig. 5 with image from Yang et al., 2019
embryonic structure cap1 expression decreased amount, abnormal AB + MO1-pabpc1a Fig. 5 with image from Yang et al., 2019
gastrulation delayed, abnormal AB + MO1-pabpc1a Fig. 5 with image from Yang et al., 2019
gastrulation increased duration, abnormal AB + MO1-pabpc1a Fig. 5 with image from Yang et al., 2019
somitogenesis delayed, abnormal AB + MO1-pabpc1a Fig. 5 with image from Yang et al., 2019
whole organism morphology, abnormal ya101Tg + MO1-pabpc1a Fig. 5 with image from Mishima et al., 2012
whole organism ribosome decreased amount, abnormal WT + MO1-pabpc1a Fig. 5 with image from Mishima et al., 2012
Phenotype of all Fish created by or utilizing MO1-pabpc1a
Phenotype Fish Conditions Figures
somitogenesis delayed, abnormal AB + MO1-pabpc1a standard conditions Fig. 5 with image from Yang et al., 2019
embryonic structure cap1 expression decreased amount, abnormal AB + MO1-pabpc1a standard conditions Fig. 5 with image from Yang et al., 2019
gastrulation delayed, abnormal AB + MO1-pabpc1a standard conditions Fig. 5 with image from Yang et al., 2019
embryonic structure tpp2 expression decreased amount, abnormal AB + MO1-pabpc1a standard conditions Fig. 5 with image from Yang et al., 2019
embryonic structure tex2 expression decreased amount, abnormal AB + MO1-pabpc1a standard conditions Fig. 5 with image from Yang et al., 2019
gastrulation increased duration, abnormal AB + MO1-pabpc1a standard conditions Fig. 5 with image from Yang et al., 2019
whole organism ribosome decreased amount, abnormal WT + MO1-pabpc1a standard conditions Fig. 5 with image from Mishima et al., 2012
whole organism morphology, abnormal ya101Tg + MO1-pabpc1a standard conditions Fig. 5 with image from Mishima et al., 2012
somitogenesis delayed, abnormal AB + MO1-pabpc1a + MO3-ybx1 standard conditions Fig. 5 with image from Yang et al., 2019
gastrulation delayed, abnormal AB + MO1-pabpc1a + MO3-ybx1 standard conditions Fig. 5 with image from Yang et al., 2019
embryonic structure cap1 expression decreased amount, abnormal AB + MO1-pabpc1a + MO3-ybx1 standard conditions Fig. 5 with image from Yang et al., 2019
embryonic structure tpp2 expression amount, ameliorated AB + MO1-pabpc1a + MO3-ybx1 standard conditions Fig. 5 with image from Yang et al., 2019
embryonic structure tex2 expression decreased amount, abnormal AB + MO1-pabpc1a + MO3-ybx1 standard conditions Fig. 5 with image from Yang et al., 2019
gastrulation increased duration, abnormal AB + MO1-pabpc1a + MO3-ybx1 standard conditions Fig. 5 with image from Yang et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.