header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-120216-4
Morpholino Name: MO1-cep41
Target: cep41 (1)
Sequence:
5' - CATCTTCCAGCAGCAGAGCTTCGGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-cep41 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-cep41 No data available
PHENOTYPE
Phenotype resulting from MO1-cep41
Phenotype Figures
anterior commissure has fewer parts of type anterior commissure axon, abnormal Fig. 1 with image from Patowary et al., 2019
brain hydrocephalic, abnormal Fig. 2Fig. S4 from Lee et al., 2012
caudal commissure has fewer parts of type caudal commissure axon, abnormal Fig. 1 with image from Patowary et al., 2019
caudal fin curved, abnormal Fig. S1 from Patowary et al., 2019
cranial neural crest cell cell migration decreased process quality, abnormal Fig. 2 with image from Patowary et al., 2019
cranial neural crest cell cell migration delayed, abnormal Fig. 2 with image from Patowary et al., 2019
determination of heart left/right asymmetry disrupted, abnormal Fig. 2 from Lee et al., 2012
epithelial cilium movement involved in extracellular fluid movement disrupted, abnormal Fig. S12 from Lee et al., 2012
heart edematous, abnormal Fig. 2Fig. S4 from Lee et al., 2012
heart inverted, abnormal Fig. 2 from Lee et al., 2012
hindbrain migratory cranial neural crest cell mislocalised, abnormal Fig. 2 with image from Patowary et al., 2019
inner ear altered number of otolith, abnormal Fig. S4 from Lee et al., 2012
Kupffer's vesicle cilium non-functional, abnormal Fig. S12 from Lee et al., 2012
migratory cranial neural crest Ab7-sox10 labeling increased distribution, abnormal Fig. 2 with image from Patowary et al., 2019
otolith position, abnormal Fig. S4 from Lee et al., 2012
pericardium edematous, abnormal Fig. S1 from Patowary et al., 2019
post-vent region curved, abnormal Fig. 2 from Lee et al., 2012
post-vent region morphology, abnormal Fig. S4 from Lee et al., 2012
pronephric duct axonemal microtubule decreased size, abnormal Fig. 3Fig. S11 from Lee et al., 2012
pronephric duct axonemal microtubule increased amount, abnormal Fig. 3Fig. S11 from Lee et al., 2012
pronephric duct axoneme morphology, abnormal Fig. 3Fig. S11 from Lee et al., 2012
rhombomere disorganized, abnormal Fig. 1 with image from Patowary et al., 2019
supraoptic tract has fewer parts of type supraoptic tract axon, abnormal Fig. 1 with image from Patowary et al., 2019
tubulin-glutamic acid ligase activity disrupted, abnormal Fig. S10 from Lee et al., 2012
white matter morphology, abnormal Fig. 1 with image from Patowary et al., 2019
whole organism social behavior process quality, abnormal Fig. 3 with image from Patowary et al., 2019

Phenotype of all Fish created by or utilizing MO1-cep41
Phenotype Fish Conditions Figures
cranial neural crest cell cell migration decreased process quality, abnormal AB + MO1-cep41 standard conditions Fig. 2 with image from Patowary et al., 2019
hindbrain migratory cranial neural crest cell mislocalised, abnormal AB + MO1-cep41 standard conditions Fig. 2 with image from Patowary et al., 2019
supraoptic tract has fewer parts of type supraoptic tract axon, abnormal AB + MO1-cep41 control Fig. 1 with image from Patowary et al., 2019
white matter morphology, abnormal AB + MO1-cep41 control Fig. 1 with image from Patowary et al., 2019
whole organism social behavior process quality, abnormal AB + MO1-cep41 standard conditions Fig. 3 with image from Patowary et al., 2019
rhombomere disorganized, abnormal AB + MO1-cep41 control Fig. 1 with image from Patowary et al., 2019
caudal fin curved, abnormal AB + MO1-cep41 control Fig. S1 from Patowary et al., 2019
caudal commissure has fewer parts of type caudal commissure axon, abnormal AB + MO1-cep41 control Fig. 1 with image from Patowary et al., 2019
pericardium edematous, abnormal AB + MO1-cep41 control Fig. S1 from Patowary et al., 2019
migratory cranial neural crest Ab7-sox10 labeling increased distribution, abnormal AB + MO1-cep41 standard conditions Fig. 2 with image from Patowary et al., 2019
cranial neural crest cell cell migration delayed, abnormal AB + MO1-cep41 standard conditions Fig. 2 with image from Patowary et al., 2019
anterior commissure has fewer parts of type anterior commissure axon, abnormal AB + MO1-cep41 control Fig. 1 with image from Patowary et al., 2019
pronephric duct axonemal microtubule increased amount, abnormal WT + MO1-cep41 standard conditions Fig. 3Fig. S11 from Lee et al., 2012
inner ear altered number of otolith, abnormal WT + MO1-cep41 standard conditions Fig. S4 from Lee et al., 2012
pronephric duct axonemal microtubule decreased size, abnormal WT + MO1-cep41 standard conditions Fig. 3Fig. S11 from Lee et al., 2012
post-vent region morphology, abnormal WT + MO1-cep41 standard conditions Fig. S4 from Lee et al., 2012
brain hydrocephalic, abnormal WT + MO1-cep41 standard conditions Fig. 2Fig. S4 from Lee et al., 2012
otolith position, abnormal WT + MO1-cep41 standard conditions Fig. S4 from Lee et al., 2012
heart edematous, abnormal WT + MO1-cep41 standard conditions Fig. 2Fig. S4 from Lee et al., 2012
Kupffer's vesicle cilium non-functional, abnormal WT + MO1-cep41 standard conditions Fig. S12 from Lee et al., 2012
pronephric duct axoneme morphology, abnormal WT + MO1-cep41 standard conditions Fig. 3Fig. S11 from Lee et al., 2012
tubulin-glutamic acid ligase activity disrupted, abnormal WT + MO1-cep41 standard conditions Fig. S10 from Lee et al., 2012
epithelial cilium movement involved in extracellular fluid movement disrupted, abnormal WT + MO1-cep41 standard conditions Fig. S12 from Lee et al., 2012
post-vent region curved, abnormal WT + MO1-cep41 standard conditions Fig. 2 from Lee et al., 2012
heart inverted, abnormal twu34Tg + MO1-cep41 standard conditions Fig. 2 from Lee et al., 2012
determination of heart left/right asymmetry disrupted, abnormal twu34Tg + MO1-cep41 standard conditions Fig. 2 from Lee et al., 2012
OTHER MO1-cep41 MORPHOLINO PAGES No links to external sites
CITATIONS (2)