Morpholino

MO1-uhrf1

ID
ZDB-MRPHLNO-120126-1
Name
MO1-uhrf1
Previous Names
None
Target
Sequence
5' - CACCTGAATCCACATGGCGGCAAAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-uhrf1
No data available
Phenotype
Phenotype resulting from MO1-uhrf1
Phenotype of all Fish created by or utilizing MO1-uhrf1
Phenotype Fish Conditions Figures
whole organism dead, abnormal AB + MO1-uhrf1 standard conditions Fig. 4 from Chu et al., 2012
eye decreased circumference, abnormal AB + MO1-uhrf1 standard conditions Fig. S4 from Chu et al., 2012
midbrain hindbrain boundary morphology, abnormal AB + MO1-uhrf1 standard conditions Fig. 4Fig. S4 from Chu et al., 2012
cardiac ventricle dilated, abnormal AB + MO1-uhrf1 standard conditions Fig. 4 from Chu et al., 2012
brain decreased size, abnormal AB + MO1-uhrf1 standard conditions Fig. 4 from Chu et al., 2012
eye decreased size, abnormal AB + MO1-uhrf1 standard conditions Fig. 4Fig. S4 from Chu et al., 2012
whole organism decreased life span, abnormal AB + MO1-uhrf1 standard conditions Fig. 4 from Chu et al., 2012
embryo development disrupted, abnormal AB + MO1-uhrf1 standard conditions Fig. 4Fig. S4 from Chu et al., 2012
hemopoiesis disrupted, abnormal AB + MO1-uhrf1 standard conditions Fig. S7 from Deveau et al., 2015
whole organism decreased life span, abnormal AB + MO1-uhrf1 + MO4-tp53 standard conditions Fig. S5 from Chu et al., 2012
whole organism dead, abnormal AB + MO1-uhrf1 + MO4-tp53 standard conditions Fig. S5 from Chu et al., 2012
eye decreased circumference, abnormal AB + MO1-uhrf1 + MO4-tp53 standard conditions Fig. S5 from Chu et al., 2012
midbrain hindbrain boundary morphology, abnormal AB + MO1-uhrf1 + MO4-tp53 standard conditions Fig. S5 from Chu et al., 2012
embryo development disrupted, abnormal AB + MO1-uhrf1 + MO4-tp53 standard conditions Fig. S5 from Chu et al., 2012
eye decreased size, abnormal AB + MO1-uhrf1 + MO4-tp53 standard conditions Fig. S5 from Chu et al., 2012
ventral wall of dorsal aorta myb expression decreased amount, abnormal WT + MO1-uhrf1 standard conditions Fig. 4 from Manesia et al., 2017
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal WT + MO1-uhrf1 standard conditions Fig. 5 from Manesia et al., 2017
whole organism lcp1 expression decreased amount, abnormal WT + MO1-uhrf1 standard conditions Fig. 3 from Manesia et al., 2017
liver decreased size, abnormal gz15Tg + MO1-uhrf1 standard conditions Fig. 4 from Chu et al., 2012
hemopoiesis process quality, abnormal sd2Tg; zf531Tg + MO1-uhrf1 standard conditions Fig. 3 from Manesia et al., 2017
hemopoiesis process quality, ameliorated hsi1Tg; zdf13Tg + MO1-uhrf1 heat shock Fig. S7 from Deveau et al., 2015
Citations