Morpholino

MO1-rac2

ID
ZDB-MRPHLNO-111103-1
Name
MO1-rac2
Previous Names
None
Target
Sequence
5' - CCACCACACACTTTATTGCTTGCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rac2
No data available
Phenotype
Phenotype resulting from MO1-rac2
Phenotype Fish Figures
neutrophil spatial pattern, abnormal WT + MO1-rac2 Fig. 4 with image from Deng et al., 2011
neutrophil homeostasis disrupted, abnormal WT + MO1-rac2 Fig. 4 with image from Deng et al., 2011
Phenotype of all Fish created by or utilizing MO1-rac2
Phenotype Fish Conditions Figures
defense response to Gram-negative bacterium disrupted, abnormal WT + MO1-rac2 bacterial treatment by injection: Pseudomonas aeruginosa Fig. 2 with image from Deng et al., 2011
neutrophil mediated immunity disrupted, abnormal WT + MO1-rac2 bacterial treatment by injection: Pseudomonas aeruginosa Fig. 2 with image from Deng et al., 2011
neutrophil chemotaxis disrupted, abnormal WT + MO1-rac2 physical alteration: caudal fin Fig. 1 with image from Deng et al., 2011
neutrophil spatial pattern, abnormal WT + MO1-rac2 standard conditions Fig. 4 with image from Deng et al., 2011
neutrophil homeostasis disrupted, abnormal WT + MO1-rac2 standard conditions Fig. 4 with image from Deng et al., 2011
neutrophil chemotaxis disrupted, abnormal WT + MO1-rac2 bacterial treatment by injection: Pseudomonas aeruginosa Fig. 2 with image from Deng et al., 2011
neutrophil mediated immunity disrupted, abnormal WT + MO1-rac2 physical alteration: caudal fin Fig. 1 with image from Deng et al., 2011
response to wounding disrupted, abnormal WT + MO1-rac2 physical alteration: caudal fin Fig. 1 with image from Deng et al., 2011
thymus primordium leukocyte coro1a expression decreased amount, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 4 from Lu et al., 2020
thymus lcp1 expression decreased amount, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 4 from Lu et al., 2020
caudal hematopoietic tissue pro-T cell myb expression increased amount, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 4 from Lu et al., 2020
thymus leukocyte coro1a expression decreased amount, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 4 from Lu et al., 2020
thymus T cell rag1 expression decreased amount, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 2 from Lu et al., 2020
caudal hematopoietic tissue leukocyte lcp1 expression increased amount, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 4 from Lu et al., 2020
thymus T cell ccr9a expression decreased amount, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 2 from Lu et al., 2020
thymus T cell ccr9b expression decreased amount, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 2 from Lu et al., 2020
caudal hematopoietic tissue leukocyte coro1a expression increased amount, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 4 from Lu et al., 2020
leukocyte migration disrupted, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 4 from Lu et al., 2020
caudal hematopoietic tissue pro-T cell irf4a expression increased amount, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 4 from Lu et al., 2020
thymus T cell lck expression decreased amount, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 2 from Lu et al., 2020
caudal hematopoietic tissue pro-T cell ccr9a expression increased amount, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 4 from Lu et al., 2020
thymus leukocyte lcp1 expression decreased amount, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 4 from Lu et al., 2020
pro-T cell cell migration disrupted, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 4 from Lu et al., 2020
caudal hematopoietic tissue pro-T cell mislocalised, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 4 from Lu et al., 2020
caudal hematopoietic tissue leukocyte mislocalised, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 4 from Lu et al., 2020
thymus T cell decreased amount, abnormal hkz04tTg + MO1-rac2 + MO2-rac2 standard conditions Fig. 2 from Lu et al., 2020
thymus T cell decreased amount, abnormal zf411Tg + MO1-rac2 + MO2-rac2 standard conditions Fig. 2 from Lu et al., 2020
caudal fin EGFP expression amount, ameliorated mir223pu18/pu18; nc1Tg + MO1-rac2 + MO1-spi1b transection: caudal fin Fig. 4 with image from Zhou et al., 2018
caudal fin canonical NF-kappaB signal transduction process quality, ameliorated mir223pu18/pu18; nc1Tg + MO1-rac2 + MO1-spi1b transection: caudal fin Fig. 4 with image from Zhou et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.