Morpholino
MO1-pax9
- ID
- ZDB-MRPHLNO-111102-2
- Name
- MO1-pax9
- Previous Names
- None
- Target
- Sequence
-
5' - CCAAAGGCTGGCTCTAGTTATGCAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pax9
No data available
Phenotype
Phenotype resulting from MO1-pax9
1 - 5 of 10 Show all
Phenotype of all Fish created by or utilizing MO1-pax9
1 - 5 of 17 Show all
Citations
- Murayama, E., Vivier, C., Schmidt, A., Herbomel, P. (2023) Alcam-a and Pdgfr-α are essential for the development of sclerotome-derived stromal cells that support hematopoiesis. Nature communications. 14:11711171
- Pak, B., Schmitt, C.E., Oh, S., Kim, J.D., Choi, W., Han, O., Kim, M., Kim, M.J., Ham, H.J., Kim, S., Huh, T.L., Kim, J.I., Jin, S.W. (2020) Pax9 is essential for granulopoiesis but dispensable for erythropoiesis in zebrafish. Biochemical and Biophysical Research Communications. 534:359-366
- Charbord, P., Pouget, C., Binder, H., Dumont, F., Stik, G., Levy, P., Allain, F., Marchal, C., Richter, J., Uzan, B., Pflumio, F., Letourneur, F., Wirth, H., Dzierzak, E., Traver, D., Jaffredo, T., Durand, C. (2014) A Systems Biology Approach for Defining the Molecular Framework of the Hematopoietic Stem Cell Niche. Cell Stem Cell. 15(3):376-91
- Swartz, M.E., Sheehan-Rooney, K., Dixon, M.J., and Eberhart, J.K. (2011) Examination of a palatogenic gene program in zebrafish. Developmental Dynamics : an official publication of the American Association of Anatomists. 240(9):2204-2220
1 - 4 of 4
Show