Morpholino

MO1-pax9

ID

ZDB-MRPHLNO-111102-2

Name

MO1-pax9

Previous Names

None

Target

pax9 (1)

Sequence

5' - CCAAAGGCTGGCTCTAGTTATGCAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-pax9

No data available

Phenotype

Phenotype resulting from MO1-pax9

Phenotype	Fish	Figures
ceratobranchial 5 tooth decreased amount, abnormal	AB + MO1-pax9	Fig. 8 from Swartz et al., 2011
ethmoid cartilage chondrocyte disorganized, abnormal	AB + MO1-pax9	Fig. 8 from Swartz et al., 2011
hyomandibula bifurcated, abnormal	AB + MO1-pax9	Fig. 8 from Swartz et al., 2011
hyomandibula cylindrical, abnormal	AB + MO1-pax9	Fig. 8 from Swartz et al., 2011
hyomandibula decreased size, abnormal	AB + MO1-pax9	Fig. 8 from Swartz et al., 2011
neurocranium decreased length, abnormal	AB + MO1-pax9	Fig. 8 from Swartz et al., 2011
neutrophil decreased amount, abnormal	WT + MO1-pax9	Fig. 3 from Pak et al., 2020
parasphenoid shape, abnormal	AB + MO1-pax9	Fig. 8 from Swartz et al., 2011
trabecula cranii unfused from neurocranium posterior region, abnormal	AB + MO1-pax9	Fig. 8 from Swartz et al., 2011
trabecula cranii chondrocyte disorganized, abnormal	AB + MO1-pax9	Fig. 8 from Swartz et al., 2011

Phenotype of all Fish created by or utilizing MO1-pax9

Phenotype	Fish	Conditions	Figures
ceratobranchial 5 tooth decreased amount, abnormal	AB + MO1-pax9	standard conditions	Fig. 8 from Swartz et al., 2011
trabecula cranii unfused from neurocranium posterior region, abnormal	AB + MO1-pax9	standard conditions	Fig. 8 from Swartz et al., 2011
neurocranium decreased length, abnormal	AB + MO1-pax9	standard conditions	Fig. 8 from Swartz et al., 2011
hyomandibula cylindrical, abnormal	AB + MO1-pax9	standard conditions	Fig. 8 from Swartz et al., 2011
hyomandibula bifurcated, abnormal	AB + MO1-pax9	standard conditions	Fig. 8 from Swartz et al., 2011
hyomandibula decreased size, abnormal	AB + MO1-pax9	standard conditions	Fig. 8 from Swartz et al., 2011
trabecula cranii chondrocyte disorganized, abnormal	AB + MO1-pax9	standard conditions	Fig. 8 from Swartz et al., 2011
parasphenoid shape, abnormal	AB + MO1-pax9	standard conditions	Fig. 8 from Swartz et al., 2011
ethmoid cartilage chondrocyte disorganized, abnormal	AB + MO1-pax9	standard conditions	Fig. 8 from Swartz et al., 2011
neutrophil increased amount, abnormal	WT + MO1-pax9	bacterial treatment by injection: Acinetobacter baumannii	Fig. 3 from Pak et al., 2020
neutrophil increased amount, abnormal	WT + MO1-pax9	bacterial treatment by injection: Enterococcus faecium	Fig. 3 from Pak et al., 2020
neutrophil increased amount, abnormal	WT + MO1-pax9	bacterial treatment by injection: Staphylococcus epidermidis	Fig. 3 from Pak et al., 2020
neutrophil increased amount, abnormal	WT + MO1-pax9	bacterial treatment by injection: Staphylococcus aureus	Fig. 3 from Pak et al., 2020
neutrophil increased amount, abnormal	WT + MO1-pax9	bacterial treatment by injection: Enterococcus faecalis	Fig. 3 from Pak et al., 2020
neutrophil increased amount, abnormal	WT + MO1-pax9	bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium	Fig. 3 from Pak et al., 2020
neutrophil decreased amount, abnormal	WT + MO1-pax9	control	Fig. 3 from Pak et al., 2020
neutrophil increased amount, abnormal	WT + MO1-pax9	bacterial treatment by injection: Escherichia coli	Fig. 3 from Pak et al., 2020

Citations