Morpholino

MO1-smyhc

ID
ZDB-MRPHLNO-110830-1
Name
MO1-smyhc
Previous Names
  • smyhc2 MO (1)
Targets
Sequence
5' - GCCATCACAGCATCCCCCATCTTTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
View all 4 target locations
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-smyhc
No data available
Phenotype
Phenotype resulting from MO1-smyhc
No data available
Phenotype of all Fish created by or utilizing MO1-smyhc
Phenotype Fish Conditions Figures
thigmotaxis arrested, abnormal WT + MO1-smyhc + MO2-smyhc1 standard conditions Fig. 5 from Hirata et al., 2012
trunk musculature slow muscle cell non-contractile, abnormal WT + MO1-smyhc + MO2-smyhc1 standard conditions Fig. 5 from Hirata et al., 2012
myotome slow muscle cell decreased functionality, abnormal WT + MO1-smyhc + MO2-smyhc1 standard conditions Fig. 7 with image from Naganawa et al., 2011
muscle contraction decreased intensity, abnormal WT + MO1-smyhc + MO2-smyhc1 standard conditions Fig. 7 with image from Naganawa et al., 2011
post-vent region slow muscle cell non-contractile, abnormal WT + MO1-smyhc + MO2-smyhc1 standard conditions Fig. 5 from Hirata et al., 2012
slow-twitch skeletal muscle fiber contraction process quality, abnormal WT + MO1-smyhc + MO2-smyhc1 standard conditions Fig. 7 with image from Naganawa et al., 2011
larval locomotory behavior process quality, abnormal WT + MO1-smyhc + MO2-smyhc1 standard conditions Fig. 7 with image from Naganawa et al., 2011
myotome fast muscle cell decreased functionality, abnormal WT + MO1-flii + MO1-smyhc + MO2-smyhc1 standard conditions Fig. 7 with image from Naganawa et al., 2011
larval locomotory behavior process quality, abnormal WT + MO1-flii + MO1-smyhc + MO2-smyhc1 standard conditions Fig. 7 with image from Naganawa et al., 2011
slow-twitch skeletal muscle fiber contraction process quality, abnormal WT + MO1-flii + MO1-smyhc + MO2-smyhc1 standard conditions Fig. 7 with image from Naganawa et al., 2011
myotome slow muscle cell decreased functionality, abnormal WT + MO1-flii + MO1-smyhc + MO2-smyhc1 standard conditions Fig. 7 with image from Naganawa et al., 2011
fast-twitch skeletal muscle fiber contraction process quality, abnormal WT + MO1-flii + MO1-smyhc + MO2-smyhc1 standard conditions Fig. 7 with image from Naganawa et al., 2011
muscle contraction decreased intensity, abnormal WT + MO1-flii + MO1-smyhc + MO2-smyhc1 standard conditions Fig. 7 with image from Naganawa et al., 2011
trunk musculature slow muscle cell non-contractile, abnormal WT + MO1-smyhc + MO2-smyhc1 + MO4-ryr1b standard conditions Fig. 5 from Hirata et al., 2012
myotome fast muscle cell decreased functionality, abnormal WT + MO1-smyhc + MO2-smyhc1 + MO4-ryr1b standard conditions Fig. 7 with image from Naganawa et al., 2011
post-vent region fast muscle cell non-contractile, abnormal WT + MO1-smyhc + MO2-smyhc1 + MO4-ryr1b standard conditions Fig. 5 from Hirata et al., 2012
post-vent region slow muscle cell non-contractile, abnormal WT + MO1-smyhc + MO2-smyhc1 + MO4-ryr1b standard conditions Fig. 5 from Hirata et al., 2012
locomotion involved in locomotory behavior arrested, abnormal WT + MO1-smyhc + MO2-smyhc1 + MO4-ryr1b standard conditions Fig. 5 from Hirata et al., 2012
thigmotaxis arrested, abnormal WT + MO1-smyhc + MO2-smyhc1 + MO4-ryr1b standard conditions Fig. 5 from Hirata et al., 2012
slow-twitch skeletal muscle fiber contraction process quality, abnormal WT + MO1-smyhc + MO2-smyhc1 + MO4-ryr1b standard conditions Fig. 7 with image from Naganawa et al., 2011
trunk musculature fast muscle cell non-contractile, abnormal WT + MO1-smyhc + MO2-smyhc1 + MO4-ryr1b standard conditions Fig. 5 from Hirata et al., 2012
muscle contraction decreased intensity, abnormal WT + MO1-smyhc + MO2-smyhc1 + MO4-ryr1b standard conditions Fig. 7 with image from Naganawa et al., 2011
myotome slow muscle cell decreased functionality, abnormal WT + MO1-smyhc + MO2-smyhc1 + MO4-ryr1b standard conditions Fig. 7 with image from Naganawa et al., 2011
fast-twitch skeletal muscle fiber contraction process quality, abnormal WT + MO1-smyhc + MO2-smyhc1 + MO4-ryr1b standard conditions Fig. 7 with image from Naganawa et al., 2011
larval locomotory behavior process quality, abnormal WT + MO1-smyhc + MO2-smyhc1 + MO4-ryr1b standard conditions Fig. 7 with image from Naganawa et al., 2011
Citations