Morpholino

MO1-plekha7a

ID
ZDB-MRPHLNO-110824-1
Name
MO1-plekha7a
Previous Names
  • hadp1 MO (1)
  • MO1-plekha7
Target
Sequence
5' - GATCAACTCTTACCTGCTTGTAAAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-plekha7a
Expressed Gene Anatomy Figures
bmp4 Fig. 5 with image from Wythe et al., 2011
myh6 Fig. 5 with image from Wythe et al., 2011
myh7 Fig. 5 with image from Wythe et al., 2011
myl7 Fig. 4 with image from Wythe et al., 2011
myod1 Fig. 4 with image from Wythe et al., 2011
nkx2.5 Fig. 4 with image from Wythe et al., 2011
notch1b Fig. 5 with image from Wythe et al., 2011
Phenotype
Phenotype resulting from MO1-plekha7a
Phenotype Fish Figures
atrial ventricular junction remodeling disrupted, abnormal twu34Tg + MO1-plekha7a Fig. 5 with image from Wythe et al., 2011
atrioventricular canal cardiac muscle cell morphology, abnormal twu34Tg + MO1-plekha7a Fig. 5 with image from Wythe et al., 2011
blood circulation disrupted, abnormal AB + MO1-plekha7a Fig. 2 with image from Wythe et al., 2011
cardiac conduction disrupted, abnormal AB + MO1-plekha7a Fig. 6 with image from Wythe et al., 2011
cardiac ventricle action potential, abnormal AB + MO1-plekha7a Fig. 6 with image from Wythe et al., 2011
cardiac ventricle decreased contractility, abnormal AB + MO1-plekha7a Fig. 3 with image,  text only from Wythe et al., 2011
heart contraction decreased rate, abnormal AB + MO1-plekha7a Fig. 3 with image,  text only from Wythe et al., 2011
pericardium edematous, abnormal AB + MO1-plekha7a Fig. 2 with image from Wythe et al., 2011
regulation of cardiac muscle contraction by calcium ion signaling disrupted, abnormal AB + MO1-plekha7a Fig. 7 with image from Wythe et al., 2011
Phenotype of all Fish created by or utilizing MO1-plekha7a
Phenotype Fish Conditions Figures
blood circulation disrupted, abnormal AB + MO1-plekha7a standard conditions Fig. 2 with image from Wythe et al., 2011
heart contraction decreased rate, abnormal AB + MO1-plekha7a standard conditions Fig. 3 with image,  text only from Wythe et al., 2011
cardiac ventricle decreased contractility, abnormal AB + MO1-plekha7a standard conditions Fig. 3 with image,  text only from Wythe et al., 2011
pericardium edematous, abnormal AB + MO1-plekha7a standard conditions Fig. 2 with image from Wythe et al., 2011
cardiac conduction disrupted, abnormal AB + MO1-plekha7a standard conditions Fig. 6 with image from Wythe et al., 2011
cardiac ventricle action potential, abnormal AB + MO1-plekha7a standard conditions Fig. 6 with image from Wythe et al., 2011
regulation of cardiac muscle contraction by calcium ion signaling disrupted, abnormal AB + MO1-plekha7a standard conditions Fig. 7 with image from Wythe et al., 2011
atrioventricular canal cardiac muscle cell morphology, abnormal twu34Tg + MO1-plekha7a standard conditions Fig. 5 with image from Wythe et al., 2011
atrial ventricular junction remodeling disrupted, abnormal twu34Tg + MO1-plekha7a standard conditions Fig. 5 with image from Wythe et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.