Morpholino

MO1-npc1

ID
ZDB-MRPHLNO-110810-1
Name
MO1-npc1
Previous Names
None
Target
Sequence
5' - TGTGGTTTCTCCCCAGCAGAAGCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: 2
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-npc1
Expressed Gene Anatomy Figures
foxd3 Fig. 9 from Schwend et al., 2011
pcdh8 Fig. 9 from Schwend et al., 2011
tbxta Fig. 4,  Fig. 9 from Schwend et al., 2011
Phenotype
Phenotype resulting from MO1-npc1
Phenotype Fish Figures
actin cytoskeleton organization disrupted, abnormal WT + MO1-npc1 Fig. 7 from Schwend et al., 2011
blood island thrombocyte absent, abnormal la2Tg + MO1-npc1 Fig. 5 from Louwette et al., 2013
blood island thrombocyte decreased amount, abnormal la2Tg + MO1-npc1 Fig. 5 from Louwette et al., 2013
brain morphology, abnormal WT + MO1-npc1 Fig. 4 from Louwette et al., 2013
cell death increased occurrence, abnormal WT + MO1-npc1 Fig. 9 from Schwend et al., 2011
cerebellum cholesterol increased amount, abnormal AB/TL + MO1-npc1 Fig. 3 with image from Cook et al., 2020
cerebellum ganglioside GM1 increased amount, abnormal AB/TL + MO1-npc1 Fig. 4 with image from Cook et al., 2020
cholesterol transport process quality, abnormal WT + MO1-npc1 Fig. 1 from Schwend et al., 2011
epiboly involved in gastrulation with mouth forming second delayed, abnormal WT + MO1-npc1 Fig. 3,  Fig. 4,  Fig. 6,  Fig. 8 from Schwend et al., 2011
eye morphology, abnormal WT + MO1-npc1 Fig. 4 from Louwette et al., 2013
forebrain cholesterol increased amount, abnormal AB/TL + MO1-npc1 Fig. 3 with image from Cook et al., 2020
forebrain ganglioside GM1 increased amount, abnormal AB/TL + MO1-npc1 Fig. 4 with image from Cook et al., 2020
hatching decreased rate, abnormal WT + MO1-npc1 Fig. 5 from Liao et al., 2018
head malformed, abnormal WT + MO1-npc1 Fig. 4 from Louwette et al., 2013
hindbrain cholesterol increased amount, abnormal AB/TL + MO1-npc1 Fig. 3 with image from Cook et al., 2020
hindbrain ganglioside GM1 increased amount, abnormal AB/TL + MO1-npc1 Fig. 4 with image from Cook et al., 2020
intracellular cholesterol transport disrupted, abnormal WT + MO1-npc1 Fig. 7 with image from Chu et al., 2015
lateral mesoderm increased width, abnormal WT + MO1-npc1 Fig. 9 from Schwend et al., 2011
midbrain cholesterol increased amount, abnormal AB/TL + MO1-npc1 Fig. 3 with image from Cook et al., 2020
midbrain ganglioside GM1 increased amount, abnormal AB/TL + MO1-npc1 Fig. 4 with image from Cook et al., 2020
notochord increased width, abnormal WT + MO1-npc1 Fig. 9 from Schwend et al., 2011
nucleate erythrocyte decreased amount, abnormal sd2Tg + MO1-npc1 Fig. 5 from Louwette et al., 2013
programmed cell death increased occurrence, abnormal WT + MO1-npc1 Fig. 4 from Louwette et al., 2013
regulation of cholesterol storage disrupted, abnormal WT + MO1-npc1 Fig. 4 from Louwette et al., 2013
segmental plate increased width, abnormal WT + MO1-npc1 Fig. 9 from Schwend et al., 2011
trunk sterol spatial pattern, abnormal WT + MO1-npc1 Fig. 1 from Schwend et al., 2011
whole organism dead, abnormal la2Tg + MO1-npc1 Fig. 5 from Louwette et al., 2013
whole organism decreased length, abnormal WT + MO1-npc1 Fig. 9 from Schwend et al., 2011
whole organism viability, abnormal WT + MO1-npc1 text only from Schwend et al., 2011
whole organism cholesterol increased amount, abnormal WT + MO1-npc1 Fig. 5 from Liao et al., 2018
Fig. 7 with image from Chu et al., 2015
whole organism motor behavior decreased process quality, abnormal AB/TL + MO1-npc1 Fig. 1 with image from Cook et al., 2020
Phenotype of all Fish created by or utilizing MO1-npc1
Phenotype Fish Conditions Figures
midbrain ganglioside GM1 increased amount, abnormal AB/TL + MO1-npc1 control Fig. 4 with image from Cook et al., 2020
cerebellum ganglioside GM1 increased amount, abnormal AB/TL + MO1-npc1 control Fig. 4 with image from Cook et al., 2020
midbrain cholesterol increased amount, abnormal AB/TL + MO1-npc1 control Fig. 3 with image from Cook et al., 2020
cerebellum cholesterol increased amount, abnormal AB/TL + MO1-npc1 control Fig. 3 with image from Cook et al., 2020
forebrain cholesterol increased amount, abnormal AB/TL + MO1-npc1 control Fig. 3 with image from Cook et al., 2020
forebrain ganglioside GM1 increased amount, abnormal AB/TL + MO1-npc1 control Fig. 4 with image from Cook et al., 2020
whole organism motor behavior decreased process quality, abnormal AB/TL + MO1-npc1 control Fig. 1 with image from Cook et al., 2020
hindbrain ganglioside GM1 increased amount, abnormal AB/TL + MO1-npc1 control Fig. 4 with image from Cook et al., 2020
hindbrain cholesterol increased amount, abnormal AB/TL + MO1-npc1 control Fig. 3 with image from Cook et al., 2020
segmental plate increased width, abnormal WT + MO1-npc1 standard conditions Fig. 9 from Schwend et al., 2011
eye morphology, abnormal WT + MO1-npc1 standard conditions Fig. 4 from Louwette et al., 2013
intracellular cholesterol transport disrupted, abnormal WT + MO1-npc1 standard conditions Fig. 7 with image from Chu et al., 2015
brain morphology, abnormal WT + MO1-npc1 standard conditions Fig. 4 from Louwette et al., 2013
whole organism cholesterol increased amount, abnormal WT + MO1-npc1 standard conditions Fig. 5 from Liao et al., 2018
Fig. 7 with image from Chu et al., 2015
epiboly involved in gastrulation with mouth forming second onset quality, ameliorated WT + MO1-npc1 chemical treatment by environment: pregnenolone Fig. 8 from Schwend et al., 2011
trunk sterol spatial pattern, abnormal WT + MO1-npc1 standard conditions Fig. 1 from Schwend et al., 2011
epiboly involved in gastrulation with mouth forming second onset quality, ameliorated WT + MO1-npc1 chemical treatment by environment: dexamethasone Fig. 8 from Schwend et al., 2011
whole organism viability, abnormal WT + MO1-npc1 standard conditions text only from Schwend et al., 2011
programmed cell death increased occurrence, abnormal WT + MO1-npc1 standard conditions Fig. 4 from Louwette et al., 2013
cell death increased occurrence, abnormal WT + MO1-npc1 standard conditions Fig. 9 from Schwend et al., 2011
lateral mesoderm increased width, abnormal WT + MO1-npc1 standard conditions Fig. 9 from Schwend et al., 2011
notochord increased width, abnormal WT + MO1-npc1 standard conditions Fig. 9 from Schwend et al., 2011
head malformed, abnormal WT + MO1-npc1 standard conditions Fig. 4 from Louwette et al., 2013
regulation of cholesterol storage disrupted, abnormal WT + MO1-npc1 standard conditions Fig. 4 from Louwette et al., 2013
cholesterol transport process quality, abnormal WT + MO1-npc1 standard conditions Fig. 1 from Schwend et al., 2011
hatching decreased rate, abnormal WT + MO1-npc1 standard conditions Fig. 5 from Liao et al., 2018
epiboly involved in gastrulation with mouth forming second delayed, abnormal WT + MO1-npc1 standard conditions Fig. 3,  Fig. 4,  Fig. 6,  Fig. 8 from Schwend et al., 2011
whole organism decreased length, abnormal WT + MO1-npc1 standard conditions Fig. 9 from Schwend et al., 2011
actin cytoskeleton organization disrupted, abnormal WT + MO1-npc1 standard conditions Fig. 7 from Schwend et al., 2011
blood island thrombocyte absent, abnormal la2Tg + MO1-npc1 standard conditions Fig. 5 from Louwette et al., 2013
whole organism dead, abnormal la2Tg + MO1-npc1 standard conditions Fig. 5 from Louwette et al., 2013
blood island thrombocyte decreased amount, abnormal la2Tg + MO1-npc1 standard conditions Fig. 5 from Louwette et al., 2013
nucleate erythrocyte decreased amount, abnormal sd2Tg + MO1-npc1 standard conditions Fig. 5 from Louwette et al., 2013
Citations
TSV
1 - 5 of 5
Show
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.