Morpholino

MO1-ctsd

ID
ZDB-MRPHLNO-110722-1
Name
MO1-ctsd
Previous Names
  • T-MPO (1)
Target
Sequence
5' - CGAGCAGCAAAAAGGCGATTCTCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ctsd
No data available
Phenotype
Phenotype resulting from MO1-ctsd
Phenotype of all Fish created by or utilizing MO1-ctsd
Phenotype Fish Conditions Figures
retinal pigmented epithelium ctsd expression absent, abnormal WT + MO1-ctsd control Fig. 9 with image from Follo et al., 2011
trunk musculature muscle morphology, abnormal WT + MO1-ctsd standard conditions Fig. 2 with image from Follo et al., 2013
muscle myoseptum decreased thickness, abnormal WT + MO1-ctsd standard conditions Fig. 2 with image from Follo et al., 2013
whole organism viability, abnormal WT + MO1-ctsd standard conditions text only from Follo et al., 2011
retina lacks all parts of type retinal pigmented epithelium microvillus, abnormal WT + MO1-ctsd standard conditions Fig. 7 with imageFig. 8 with image from Follo et al., 2011
whole organism bent, abnormal WT + MO1-ctsd standard conditions Fig. 1 with image from Follo et al., 2013
swim bladder uninflated, abnormal WT + MO1-ctsd standard conditions Fig. 2 with image from Follo et al., 2013
eye decreased size, abnormal WT + MO1-ctsd standard conditions Fig. 5 with image from Follo et al., 2011
integument increased pigmentation, abnormal WT + MO1-ctsd standard conditions Fig. 5 with image from Follo et al., 2011
otolith decreased size, abnormal WT + MO1-ctsd standard conditions Fig. 5 with image from Follo et al., 2011
whole organism dead, abnormal WT + MO1-ctsd standard conditions text only from Follo et al., 2013
whole organism decreased length, abnormal WT + MO1-ctsd standard conditions Fig. 5 with image from Follo et al., 2011
myotube cell development disrupted, abnormal WT + MO1-ctsd standard conditions Fig. 5 with image from Follo et al., 2013
trunk musculature muscle cell disorganized, abnormal WT + MO1-ctsd standard conditions Fig. 2 with image from Follo et al., 2013
swim bladder inflation disrupted, abnormal WT + MO1-ctsd standard conditions Fig. 5 with image from Follo et al., 2011
semicircular canal decreased size, abnormal WT + MO1-ctsd standard conditions Fig. 5 with image from Follo et al., 2011
Citations