Morpholino

MO1-ctsd

ID

ZDB-MRPHLNO-110722-1

Name

MO1-ctsd

Previous Names

T-MPO (1)

Target

ctsd (1)

Sequence

5' - CGAGCAGCAAAAAGGCGATTCTCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ctsd

Expressed Gene	Anatomy	Figures
ctsd	(not) retinal pigmented epithelium	Fig. 9 from Follo et al., 2011

Phenotype

Phenotype resulting from MO1-ctsd

Phenotype	Fish	Figures
eye decreased size, abnormal	WT + MO1-ctsd	Fig. 5 from Follo et al., 2011
integument increased pigmentation, abnormal	WT + MO1-ctsd	Fig. 5 from Follo et al., 2011
muscle myoseptum decreased thickness, abnormal	WT + MO1-ctsd	Fig. 2 from Follo et al., 2013
myotube cell development disrupted, abnormal	WT + MO1-ctsd	Fig. 5 from Follo et al., 2013
otolith decreased size, abnormal	WT + MO1-ctsd	Fig. 5 from Follo et al., 2011
retina lacks all parts of type retinal pigmented epithelium microvillus, abnormal	WT + MO1-ctsd	Fig. 7 , Fig. 8 from Follo et al., 2011
retinal pigmented epithelium ctsd expression absent, abnormal	WT + MO1-ctsd	Fig. 9 from Follo et al., 2011
semicircular canal decreased size, abnormal	WT + MO1-ctsd	Fig. 5 from Follo et al., 2011
swim bladder uninflated, abnormal	WT + MO1-ctsd	Fig. 2 from Follo et al., 2013
swim bladder inflation disrupted, abnormal	WT + MO1-ctsd	Fig. 5 from Follo et al., 2011
trunk musculature muscle morphology, abnormal	WT + MO1-ctsd	Fig. 2 from Follo et al., 2013
trunk musculature muscle cell disorganized, abnormal	WT + MO1-ctsd	Fig. 2 from Follo et al., 2013
whole organism bent, abnormal	WT + MO1-ctsd	Fig. 1 from Follo et al., 2013
whole organism dead, abnormal	WT + MO1-ctsd	text only from Follo et al., 2013
whole organism decreased length, abnormal	WT + MO1-ctsd	Fig. 5 from Follo et al., 2011
whole organism viability, abnormal	WT + MO1-ctsd	text only from Follo et al., 2011

Phenotype of all Fish created by or utilizing MO1-ctsd

Phenotype	Fish	Conditions	Figures
retinal pigmented epithelium ctsd expression absent, abnormal	WT + MO1-ctsd	control	Fig. 9 from Follo et al., 2011
trunk musculature muscle morphology, abnormal	WT + MO1-ctsd	standard conditions	Fig. 2 from Follo et al., 2013
muscle myoseptum decreased thickness, abnormal	WT + MO1-ctsd	standard conditions	Fig. 2 from Follo et al., 2013
whole organism viability, abnormal	WT + MO1-ctsd	standard conditions	text only from Follo et al., 2011
retina lacks all parts of type retinal pigmented epithelium microvillus, abnormal	WT + MO1-ctsd	standard conditions	Fig. 7 , Fig. 8 from Follo et al., 2011
whole organism bent, abnormal	WT + MO1-ctsd	standard conditions	Fig. 1 from Follo et al., 2013
swim bladder uninflated, abnormal	WT + MO1-ctsd	standard conditions	Fig. 2 from Follo et al., 2013
eye decreased size, abnormal	WT + MO1-ctsd	standard conditions	Fig. 5 from Follo et al., 2011
integument increased pigmentation, abnormal	WT + MO1-ctsd	standard conditions	Fig. 5 from Follo et al., 2011
otolith decreased size, abnormal	WT + MO1-ctsd	standard conditions	Fig. 5 from Follo et al., 2011
whole organism dead, abnormal	WT + MO1-ctsd	standard conditions	text only from Follo et al., 2013
whole organism decreased length, abnormal	WT + MO1-ctsd	standard conditions	Fig. 5 from Follo et al., 2011
myotube cell development disrupted, abnormal	WT + MO1-ctsd	standard conditions	Fig. 5 from Follo et al., 2013
trunk musculature muscle cell disorganized, abnormal	WT + MO1-ctsd	standard conditions	Fig. 2 from Follo et al., 2013
swim bladder inflation disrupted, abnormal	WT + MO1-ctsd	standard conditions	Fig. 5 from Follo et al., 2011
semicircular canal decreased size, abnormal	WT + MO1-ctsd	standard conditions	Fig. 5 from Follo et al., 2011

Citations