Morpholino

MO3-flt1

ID
ZDB-MRPHLNO-110531-3
Name
MO3-flt1
Previous Names
None
Target
Sequence
5' - ATATCGAACATTCTCTTGGTCTTGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-flt1
No data available
Phenotype
Phenotype resulting from MO3-flt1
Phenotype of all Fish created by or utilizing MO3-flt1
Phenotype Fish Conditions Figures
Muller cell cell population proliferation increased occurrence, ameliorated AB + MO3-flt1 physical alteration: retina Fig. 2 from Mitra et al., 2022
intersegmental artery blood vessel endothelial cell increased area, abnormal WT + MO3-flt1 standard conditions Fig. 8 from Klems et al., 2020
intersegmental vessel endothelial tip cell increased width, abnormal s896Tg + MO3-flt1 standard conditions Fig. 4 with image from Krueger et al., 2011
intersegmental vein blood vessel endothelial cell increased amount, abnormal ubs1Tg + MO3-flt1 standard conditions Fig. 2 from Page et al., 2019
blood vessel morphogenesis disrupted, abnormal y1Tg + MO3-flt1 standard conditions Fig. 2 with imageFig. 3 with image from Krueger et al., 2011
blood vessel endothelial cell increased amount, abnormal y1Tg + MO3-flt1 standard conditions Fig. 3 with image from Krueger et al., 2011
intersegmental artery increased branchiness, abnormal y1Tg + MO3-flt1 standard conditions Fig. 6 with image from Bower et al., 2017
vascular sprouts has extra parts of type endothelial tip cell, abnormal y1Tg + MO3-flt1 standard conditions Fig. 3 with image from Krueger et al., 2011
sprouting angiogenesis disrupted, abnormal y1Tg + MO3-flt1 standard conditions Fig. 2 with imageFig. 3 with image from Krueger et al., 2011
intersegmental vessel disorganized, abnormal y1Tg + MO3-flt1 standard conditions Fig. 2 with imageFig. 3 with image from Krueger et al., 2011
intersegmental vessel vascular sprouts increased amount, abnormal hu5333Tg; hu7135Tg + MO3-flt1 standard conditions Fig. 4 with image from Wild et al., 2017
spinal cord has fewer parts of type CNS neuron (sensu Vertebrata), abnormal knu3Tg; s896Tg + MO3-flt1 standard conditions Fig. 5 with image from Krueger et al., 2011
intersegmental artery increased diameter, abnormal s916Tg + MO3-flt1 standard conditions Fig. 1 from Klems et al., 2020
intersegmental artery increased branchiness, exacerbated dll4uq10bh/+; y1Tg + MO3-flt1 standard conditions Fig. 6 with image from Bower et al., 2017
intersegmental artery increased diameter, abnormal flt4mu407/mu407; y1Tg + MO3-flt1 standard conditions Fig. 3 from Klems et al., 2020
intersegmental artery branched, abnormal hu4624Tg; s916Tg + MO3-flt1 standard conditions Fig. 5 with image from Krueger et al., 2011
intersegmental artery branchiness, ameliorated vegfchu5055/hu5055; y1Tg + MO3-flt1 standard conditions Fig. 6 with image from Bower et al., 2017
intersegmental artery decreased diameter, abnormal ka613Tg; s916Tg + MO3-flt1 standard conditions Fig. 2 from Klems et al., 2020
intersegmental artery branchiness, ameliorated vegfchu5055/hu5055; vegfduq9bh/uq9bh; y1Tg + MO3-flt1 standard conditions Fig. 6 with image from Bower et al., 2017
Citations