Morpholino

MO1-exoc5

ID
ZDB-MRPHLNO-110527-1
Name
MO1-exoc5
Previous Names
  • sec10e2i2-MO1 (1)
Target
Sequence
5' - AATATTCTGTAACTCACTTCTTAGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-exoc5
Expressed Gene Anatomy Figures
ins text only from Fogelgren et al., 2011
lft1 text only from Fogelgren et al., 2011
lft2 text only from Fogelgren et al., 2011
myl7 text only from Fogelgren et al., 2011
spaw text only from Fogelgren et al., 2011
wt1a Fig. 4 with image from Fogelgren et al., 2011
Phenotype
Phenotype resulting from MO1-exoc5
Phenotype Fish Figures
determination of left/right symmetry process quality, abnormal WT + MO1-exoc5 text only from Fogelgren et al., 2011
eye decreased size, abnormal WT + MO1-exoc5 Fig. 1 from Choi et al., 2015
melanosome transport delayed, abnormal WT + MO1-exoc5 Fig. 6 from Choi et al., 2015
photoreceptor cell photoreceptor outer segment absent, abnormal WT + MO1-exoc5 Fig. 4 from Choi et al., 2015
photoreceptor cell photoreceptor outer segment decreased amount, abnormal WT + MO1-exoc5 Fig. 4 from Choi et al., 2015
photoreceptor cell photoreceptor outer segment decreased length, abnormal WT + MO1-exoc5 Fig. 4 from Choi et al., 2015
photoreceptor cell photoreceptor outer segment morphology, abnormal WT + MO1-exoc5 Fig. 4 from Choi et al., 2015
post-vent region curved, abnormal WT + MO1-exoc5 Fig. 4 with image from Fogelgren et al., 2011
pronephric glomerulus disorganized, abnormal WT + MO1-exoc5 Fig. 3 with image from Fogelgren et al., 2011
retina apoptotic, abnormal WT + MO1-exoc5 Fig. 3 from Choi et al., 2015
retina decreased size, abnormal WT + MO1-exoc5 Fig. 2 from Choi et al., 2015
retina apoptotic process increased occurrence, abnormal WT + MO1-exoc5 Fig. 3 from Choi et al., 2015
retina cell decreased amount, abnormal WT + MO1-exoc5 Fig. 2 from Choi et al., 2015
retinal ganglion cell layer apoptotic, abnormal WT + MO1-exoc5 Fig. 3 from Choi et al., 2015
retinal inner nuclear layer apoptotic, abnormal WT + MO1-exoc5 Fig. 3 from Choi et al., 2015
retinal outer nuclear layer absent, abnormal WT + MO1-exoc5 Fig. 2 from Choi et al., 2015
retinal outer nuclear layer apoptotic, abnormal WT + MO1-exoc5 Fig. 3 from Choi et al., 2015
Phenotype of all Fish created by or utilizing MO1-exoc5
Phenotype Fish Conditions Figures
retina cell decreased amount, abnormal WT + MO1-exoc5 standard conditions Fig. 2 from Choi et al., 2015
pronephric glomerulus disorganized, abnormal WT + MO1-exoc5 standard conditions Fig. 3 with image from Fogelgren et al., 2011
retinal ganglion cell layer apoptotic, abnormal WT + MO1-exoc5 standard conditions Fig. 3 from Choi et al., 2015
retina decreased size, abnormal WT + MO1-exoc5 standard conditions Fig. 2 from Choi et al., 2015
retinal inner nuclear layer apoptotic, abnormal WT + MO1-exoc5 standard conditions Fig. 3 from Choi et al., 2015
retinal outer nuclear layer apoptotic, abnormal WT + MO1-exoc5 standard conditions Fig. 3 from Choi et al., 2015
melanosome transport delayed, abnormal WT + MO1-exoc5 standard conditions Fig. 6 from Choi et al., 2015
eye decreased size, abnormal WT + MO1-exoc5 standard conditions Fig. 1 from Choi et al., 2015
retina apoptotic process increased occurrence, abnormal WT + MO1-exoc5 standard conditions Fig. 3 from Choi et al., 2015
retinal outer nuclear layer absent, abnormal WT + MO1-exoc5 standard conditions Fig. 2 from Choi et al., 2015
photoreceptor cell photoreceptor outer segment decreased amount, abnormal WT + MO1-exoc5 standard conditions Fig. 4 from Choi et al., 2015
determination of left/right symmetry process quality, abnormal WT + MO1-exoc5 standard conditions text only from Fogelgren et al., 2011
photoreceptor cell photoreceptor outer segment absent, abnormal WT + MO1-exoc5 standard conditions Fig. 4 from Choi et al., 2015
photoreceptor cell photoreceptor outer segment morphology, abnormal WT + MO1-exoc5 standard conditions Fig. 4 from Choi et al., 2015
post-vent region curved, abnormal WT + MO1-exoc5 standard conditions Fig. 4 with image from Fogelgren et al., 2011
retina apoptotic, abnormal WT + MO1-exoc5 standard conditions Fig. 3 from Choi et al., 2015
photoreceptor cell photoreceptor outer segment decreased length, abnormal WT + MO1-exoc5 standard conditions Fig. 4 from Choi et al., 2015
pronephros cilium disorganized, abnormal WT + MO1-exoc5 + MO2-exoc5 standard conditions Fig. 3 with image from Fogelgren et al., 2011
determination of left/right symmetry process quality, abnormal WT + MO1-exoc5 + MO2-exoc5 standard conditions text only from Fogelgren et al., 2011
eye decreased size, abnormal WT + MO1-arl13b + MO1-exoc5 standard conditions Fig. 5 with image from Seixas et al., 2016
pericardium edematous, abnormal WT + MO1-arl13b + MO1-exoc5 standard conditions Fig. 5 with image from Seixas et al., 2016
post-vent region curved, abnormal WT + MO1-arl13b + MO1-exoc5 standard conditions Fig. 5 with image from Seixas et al., 2016
caudal fin curved, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions Fig. 3 from Choi et al., 2013
photoreceptor cell photoreceptor outer segment morphology, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions Fig. 5 from Choi et al., 2015
eye decreased size, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions Fig. 5 from Choi et al., 2015
Fig. 3 from Choi et al., 2013
pericardium edematous, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions Fig. 3 from Choi et al., 2013
retinal outer nuclear layer absent, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions Fig. 5 from Choi et al., 2015
retina apoptotic, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions text only from Choi et al., 2015
caudal fin decreased length, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions Fig. 3 from Choi et al., 2013
brain hydrocephalic, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions Fig. 3 from Choi et al., 2013
photoreceptor cell photoreceptor outer segment decreased amount, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions Fig. 5 from Choi et al., 2015
melanosome transport delayed, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions Fig. 6 from Choi et al., 2015
post-vent region curved, abnormal WT + MO1-exoc5 + MO3-pkd2 standard conditions Fig. 4 with image from Fogelgren et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.