Morpholino
MO3-acvrl1
- ID
- ZDB-MRPHLNO-110411-2
- Name
- MO3-acvrl1
- Previous Names
- None
- Target
- Sequence
-
5' - ATCGGTTTCACTCACCAACACACTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-acvrl1
No data available
Phenotype
Phenotype resulting from MO3-acvrl1
1 - 5 of 30 Show all
Phenotype of all Fish created by or utilizing MO3-acvrl1
1 - 5 of 34 Show all
Citations
- Sidhwani, P., Leerberg, D.M., Boezio, G.L.M., Capasso, T.L., Yang, H., Chi, N.C., Roman, B.L., Stainier, D.Y.R., Yelon, D. (2020) Cardiac function modulates endocardial cell dynamics to shape the cardiac outflow tract. Development (Cambridge, England). 147(12):
- Ando, K., Wang, W., Peng, D., Chiba, A., Lagendijk, A., Barske, L., Crump, J.G., Stainier, D.Y.R., Lendahl, U., Koltowska, K., Hogan, B.M., Fukuhara, S., Mochizuki, N., Betsholtz, C. (2019) Peri-arterial specification of vascular mural cells from naïve mesenchyme requires Notch signaling. Development (Cambridge, England). 146(2):
- Neal, A., Nornes, S., Payne, S., Wallace, M.D., Fritzsche, M., Louphrasitthiphol, P., Wilkinson, R.N., Chouliaras, K.M., Liu, K., Plant, K., Sholapurkar, R., Ratnayaka, I., Herzog, W., Bond, G., Chico, T., Bou-Gharios, G., De Val, S. (2019) Venous identity requires BMP signalling through ALK3. Nature communications. 10:453
- Rochon, E.R., Menon, P.G., Roman, B.L. (2016) Alk1 controls arterial endothelial cell migration in lumenized vessels. Development (Cambridge, England). 143(14):2593-602
- Rochon, E.R., Wright, D.S., Schubert, M.M., Roman, B.L. (2015) Context-specific interactions between Notch and ALK1 cannot explain ALK1-associated arteriovenous malformations. Cardiovascular research. 107(1):143-52
- Walcott, B.P. (2014) BMP signaling modulation attenuates cerebral arteriovenous malformation formation in a vertebrate model. Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism. 34(10):1688-94
- Laux, D.W., Young, S., Donovan, J.P., Mansfield, C.J., Upton, P.D., and Roman, B.L. (2013) Circulating Bmp10 acts through endothelial Alk1 to mediate flow-dependent arterial quiescence. Development (Cambridge, England). 140(16):3403-12
- Corti, P., Young, S., Chen, C.Y., Patrick, M.J., Rochon, E.R., Pekkan, K., and Roman, B.L. (2011) Interaction between alk1 and blood flow in the development of arteriovenous malformations. Development (Cambridge, England). 138(8):1573-1582
1 - 8 of 8
Show