Morpholino

MO1-setdb2

ID
ZDB-MRPHLNO-110201-1
Name
MO1-setdb2
Previous Names
  • MO1 (1)
Target
Sequence
5' - CAGGGTTCAGGAGATTTTAATGACT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-setdb2
No data available
Phenotype
Phenotype resulting from MO1-setdb2
Phenotype Fish Figures
convergent extension involved in gastrulation decreased occurrence, abnormal WT + MO1-setdb2 Fig. 1 with image,  Fig. 2 with image,  Fig. 5 with image from Du et al., 2014
determination of digestive tract left/right asymmetry disrupted, abnormal WT + MO1-setdb2 Fig. S4 with image from Xu et al., 2010
determination of heart left/right asymmetry disrupted, abnormal WT + MO1-setdb2 Fig. S4 with image from Xu et al., 2010
determination of left/right asymmetry in diencephalon disrupted, abnormal WT + MO1-setdb2 Fig. S4 with image from Xu et al., 2010
determination of liver left/right asymmetry disrupted, abnormal WT + MO1-setdb2 Fig. S4 with image from Xu et al., 2010
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO1-setdb2 Fig. S4 with image from Xu et al., 2010
diencephalon structure, abnormal WT + MO1-setdb2 Fig. S4 with image from Xu et al., 2010
gut centered, abnormal WT + MO1-setdb2 Fig. S4 with image from Xu et al., 2010
gut mislocalised radially, abnormal WT + MO1-setdb2 Fig. S4 with image from Xu et al., 2010
heart tube centered, abnormal WT + MO1-setdb2 Fig. S4 with image from Xu et al., 2010
heart tube mislocalised radially, abnormal WT + MO1-setdb2 Fig. S4 with image from Xu et al., 2010
hindbrain neural keel increased width, abnormal WT + MO1-setdb2 Fig. 2 with image from Du et al., 2014
histone H3K9 methyltransferase activity magnitude, abnormal WT + MO1-setdb2 Fig. 1 with image from Xu et al., 2010
liver centered, abnormal WT + MO1-setdb2 Fig. S4 with image from Xu et al., 2010
liver mislocalised radially, abnormal WT + MO1-setdb2 Fig. S4 with image from Xu et al., 2010
neural plate increased width, abnormal WT + MO1-setdb2 Fig. 1 with image from Du et al., 2014
notochord curved, abnormal WT + MO1-setdb2 Fig. 2 with image from Du et al., 2014
notochord decreased length, abnormal WT + MO1-setdb2 Fig. 1 with image,  Fig. 2 with image from Du et al., 2014
notochord increased width, abnormal WT + MO1-setdb2 Fig. 1 with image,  Fig. 2 with image from Du et al., 2014
notochord cell orientation notochord, abnormal WT + MO1-setdb2 Fig. 1 with image from Du et al., 2014
notochord cell position, abnormal WT + MO1-setdb2 Fig. 1 with image from Du et al., 2014
notochord cell shape, abnormal WT + MO1-setdb2 Fig. 1 with image from Du et al., 2014
pancreas centered, abnormal WT + MO1-setdb2 Fig. S4 with image from Xu et al., 2010
pancreas mislocalised radially, abnormal WT + MO1-setdb2 Fig. S4 with image from Xu et al., 2010
peptidyl-lysine monomethylation increased occurrence, abnormal WT + MO1-setdb2 Fig. 1 with image from Xu et al., 2010
peptidyl-lysine trimethylation decreased occurrence, abnormal WT + MO1-setdb2 Fig. 1 with image from Xu et al., 2010
prechordal plate mislocalised posteriorly, abnormal WT + MO1-setdb2 Fig. 1 with image from Du et al., 2014
rhombomere increased width, abnormal WT + MO1-setdb2 Fig. 1 with image from Du et al., 2014
whole organism gdf3 expression increased amount, abnormal WT + MO1-setdb2 Fig. 2 with image from Du et al., 2014
Phenotype of all Fish created by or utilizing MO1-setdb2
Phenotype Fish Conditions Figures
notochord decreased length, abnormal WT + MO1-setdb2 standard conditions Fig. 1 with image,  Fig. 2 with image from Du et al., 2014
peptidyl-lysine trimethylation decreased occurrence, abnormal WT + MO1-setdb2 standard conditions Fig. 1 with image from Xu et al., 2010
gut mislocalised radially, abnormal WT + MO1-setdb2 standard conditions Fig. S4 with image from Xu et al., 2010
hindbrain neural keel increased width, abnormal WT + MO1-setdb2 standard conditions Fig. 2 with image from Du et al., 2014
notochord increased width, abnormal WT + MO1-setdb2 standard conditions Fig. 1 with image,  Fig. 2 with image from Du et al., 2014
prechordal plate mislocalised posteriorly, abnormal WT + MO1-setdb2 standard conditions Fig. 1 with image from Du et al., 2014
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO1-setdb2 standard conditions Fig. S4 with image from Xu et al., 2010
determination of liver left/right asymmetry disrupted, abnormal WT + MO1-setdb2 standard conditions Fig. S4 with image from Xu et al., 2010
histone H3K9 methyltransferase activity magnitude, abnormal WT + MO1-setdb2 standard conditions Fig. 1 with image from Xu et al., 2010
diencephalon structure, abnormal WT + MO1-setdb2 standard conditions Fig. S4 with image from Xu et al., 2010
notochord curved, abnormal WT + MO1-setdb2 standard conditions Fig. 2 with image from Du et al., 2014
liver centered, abnormal WT + MO1-setdb2 standard conditions Fig. S4 with image from Xu et al., 2010
determination of left/right asymmetry in diencephalon disrupted, abnormal WT + MO1-setdb2 standard conditions Fig. S4 with image from Xu et al., 2010
heart tube centered, abnormal WT + MO1-setdb2 standard conditions Fig. S4 with image from Xu et al., 2010
pancreas centered, abnormal WT + MO1-setdb2 standard conditions Fig. S4 with image from Xu et al., 2010
rhombomere increased width, abnormal WT + MO1-setdb2 standard conditions Fig. 1 with image from Du et al., 2014
heart tube mislocalised radially, abnormal WT + MO1-setdb2 standard conditions Fig. S4 with image from Xu et al., 2010
convergent extension involved in gastrulation decreased occurrence, abnormal WT + MO1-setdb2 standard conditions Fig. 1 with image,  Fig. 2 with image,  Fig. 5 with image from Du et al., 2014
notochord cell orientation notochord, abnormal WT + MO1-setdb2 standard conditions Fig. 1 with image from Du et al., 2014
gut centered, abnormal WT + MO1-setdb2 standard conditions Fig. S4 with image from Xu et al., 2010
liver mislocalised radially, abnormal WT + MO1-setdb2 standard conditions Fig. S4 with image from Xu et al., 2010
pancreas mislocalised radially, abnormal WT + MO1-setdb2 standard conditions Fig. S4 with image from Xu et al., 2010
notochord cell shape, abnormal WT + MO1-setdb2 standard conditions Fig. 1 with image from Du et al., 2014
neural plate increased width, abnormal WT + MO1-setdb2 standard conditions Fig. 1 with image from Du et al., 2014
whole organism gdf3 expression increased amount, abnormal WT + MO1-setdb2 standard conditions Fig. 2 with image from Du et al., 2014
notochord cell position, abnormal WT + MO1-setdb2 standard conditions Fig. 1 with image from Du et al., 2014
determination of digestive tract left/right asymmetry disrupted, abnormal WT + MO1-setdb2 standard conditions Fig. S4 with image from Xu et al., 2010
peptidyl-lysine monomethylation increased occurrence, abnormal WT + MO1-setdb2 standard conditions Fig. 1 with image from Xu et al., 2010
determination of heart left/right asymmetry disrupted, abnormal WT + MO1-setdb2 standard conditions Fig. S4 with image from Xu et al., 2010
notochord shape, ameliorated WT + MO1-setdb2 + MO2-gdf3 standard conditions Fig. 2 with image from Du et al., 2014
convergent extension involved in gastrulation occurrence, ameliorated WT + MO1-setdb2 + MO2-gdf3 standard conditions Fig. 2 with image from Du et al., 2014
hindbrain neural keel width, ameliorated WT + MO1-setdb2 + MO2-gdf3 standard conditions Fig. 2 with image from Du et al., 2014
notochord width, ameliorated WT + MO1-setdb2 + MO2-gdf3 standard conditions Fig. 2 with image from Du et al., 2014
notochord length, ameliorated WT + MO1-setdb2 + MO2-gdf3 standard conditions Fig. 2 with image from Du et al., 2014
Citations