Morpholino
MO1-id2a
- ID
- ZDB-MRPHLNO-101111-5
- Name
- MO1-id2a
- Previous Names
- None
- Target
- Sequence
-
5' - GCCTTCATGTTGACAGCAGGATTTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-id2a
No data available
Phenotype
Phenotype resulting from MO1-id2a
1 - 5 of 52 Show all
Phenotype of all Fish created by or utilizing MO1-id2a
1 - 5 of 75 Show all
Citations
- Place, E.S., Smith, J.C. (2017) Zebrafish atoh8 mutants do not recapitulate morpholino phenotypes. PLoS One. 12:e0171143
- Xu, J., Cui, J., Del Campo, A., Shin, C.H. (2016) Four and a Half LIM Domains 1b (Fhl1b) Is Essential for Regulating the Liver versus Pancreas Fate Decision and for β-Cell Regeneration. PLoS Genetics. 12:e1005831
- Khaliq, M., Choi, T.Y., So, J., Shin, D. (2015) Id2a is required for hepatic outgrowth during liver development in zebrafish. Mechanisms of Development. 138 Pt 3:399-414
- Das, A., and Crump, J.G. (2012) Bmps and id2a act upstream of twist1 to restrict ectomesenchyme potential of the cranial neural crest. PLoS Genetics. 8(5):e1002710
- Uribe, R.A., Kwon, T., Marcotte, E.M., and Gross, J.M. (2012) Id2a functions to limit Notch pathway activity and thereby influence the transition from proliferation to differentiation of retinoblasts during zebrafish retinogenesis. Developmental Biology. 371(2):280-292
- Uribe, R.A., and Gross, J.M. (2010) Id2a influences neuron and glia formation in the zebrafish retina by modulating retinoblast cell cycle kinetics. Development (Cambridge, England). 137(22):3763-3774
1 - 6 of 6
Show