Morpholino

MO1-gata3

ID
ZDB-MRPHLNO-100811-4
Name
MO1-gata3
Previous Names
None
Target
Sequence
5' - CCGGACTTACTTCCATCGTTTATTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gata3
No data available
Phenotype
Phenotype resulting from MO1-gata3
Phenotype Fish Figures
embryonic neurocranium morphogenesis decreased process quality, abnormal AB + MO1-gata3 Fig. 4 with imageFig. S1 with image from Sheehan-Rooney et al., 2013
epibranchial field sox3 expression decreased distribution, abnormal TU + MO1-gata3 Fig. 4 with image from Yao et al., 2014
neurocranial trabecula malformed, abnormal AB + MO1-gata3 Fig. 4 with image from Sheehan-Rooney et al., 2013
neurocranial trabecula chondrocyte disorganized, abnormal AB + MO1-gata3 Fig. 4 with image from Sheehan-Rooney et al., 2013
neurocranium lacks all parts of type neurocranial trabecula, abnormal WT + MO1-gata3 Fig. 4 with imageFig. S1 with image from Sheehan-Rooney et al., 2013
neurogenic field six4b expression decreased amount, abnormal TU + MO1-gata3 Fig. 4 with image from Yao et al., 2014
olfactory placode cxcr4b expression decreased distribution, abnormal TU + MO1-gata3 Fig. 4 with image from Yao et al., 2014
otic placode pax2a expression decreased amount, abnormal TU + MO1-gata3 Fig. 4 with image from Yao et al., 2014
solid lens vesicle foxe3 expression decreased distribution, abnormal TU + MO1-gata3 Fig. 4 with image from Yao et al., 2014
spinal cord Kolmer-Agduhr neuron undifferentiated, abnormal WT + MO1-gata3 Fig. 9 with image from Yang et al., 2010
ventral spinal cord interneuron differentiation disrupted, abnormal WT + MO1-gata3 Fig. 9 with image from Yang et al., 2010
whole organism fgfr3 expression decreased amount, abnormal TU + MO1-gata3 Fig. 7 with image from Yao et al., 2014
whole organism fgfr4 expression decreased amount, abnormal TU + MO1-gata3 Fig. 7 with image from Yao et al., 2014
whole organism fgfr2 expression decreased amount, abnormal TU + MO1-gata3 Fig. 7 with image from Yao et al., 2014
whole organism fgfr1a expression decreased amount, abnormal TU + MO1-gata3 Fig. 7 with image from Yao et al., 2014
whole organism bmp2b expression increased amount, abnormal TU + MO1-gata3 Fig. 7 with image from Yao et al., 2014
Phenotype of all Fish created by or utilizing MO1-gata3
Phenotype Fish Conditions Figures
embryonic neurocranium morphogenesis decreased process quality, abnormal AB + MO1-gata3 standard conditions Fig. 4 with image from Sheehan-Rooney et al., 2013
neurocranium lacks all parts of type neurocranial trabecula, abnormal AB + MO1-gata3 standard conditions Fig. 4 with image from Sheehan-Rooney et al., 2013
neurocranial trabecula chondrocyte disorganized, abnormal AB + MO1-gata3 standard conditions Fig. 4 with image from Sheehan-Rooney et al., 2013
neurocranial trabecula malformed, abnormal AB + MO1-gata3 standard conditions Fig. 4 with image from Sheehan-Rooney et al., 2013
whole organism fgfr1a expression decreased amount, abnormal TU + MO1-gata3 control Fig. 7 with image from Yao et al., 2014
epibranchial field sox3 expression decreased distribution, abnormal TU + MO1-gata3 control Fig. 4 with image from Yao et al., 2014
neurogenic field six4b expression decreased amount, abnormal TU + MO1-gata3 control Fig. 4 with image from Yao et al., 2014
whole organism bmp2b expression increased amount, abnormal TU + MO1-gata3 control Fig. 7 with image from Yao et al., 2014
whole organism fgfr3 expression decreased amount, abnormal TU + MO1-gata3 control Fig. 7 with image from Yao et al., 2014
solid lens vesicle pitx3 expression spatial pattern, ameliorated TU + MO1-gata3 chemical treatment: XAV939 Fig. 5 with image from Yao et al., 2014
solid lens vesicle foxe3 expression decreased distribution, abnormal TU + MO1-gata3 control Fig. 4 with image from Yao et al., 2014
olfactory placode cxcr4b expression decreased distribution, abnormal TU + MO1-gata3 control Fig. 4 with image from Yao et al., 2014
otic placode pax2a expression decreased amount, abnormal TU + MO1-gata3 control Fig. 4 with image from Yao et al., 2014
whole organism fgfr4 expression decreased amount, abnormal TU + MO1-gata3 control Fig. 7 with image from Yao et al., 2014
olfactory placode cxcr4b expression spatial pattern, ameliorated TU + MO1-gata3 chemical treatment: XAV939 Fig. 5 with image from Yao et al., 2014
whole organism fgfr2 expression decreased amount, abnormal TU + MO1-gata3 control Fig. 7 with image from Yao et al., 2014
neurocranium lacks all parts of type neurocranial trabecula, abnormal WT + MO1-gata3 standard conditions Fig. S1 with image from Sheehan-Rooney et al., 2013
embryonic neurocranium morphogenesis decreased process quality, abnormal WT + MO1-gata3 standard conditions Fig. S1 with image from Sheehan-Rooney et al., 2013
spinal cord Kolmer-Agduhr neuron undifferentiated, abnormal WT + MO1-gata3 standard conditions Fig. 9 with image from Yang et al., 2010
ventral spinal cord interneuron differentiation disrupted, abnormal WT + MO1-gata3 standard conditions Fig. 9 with image from Yang et al., 2010
spinal cord sox1a expression decreased distribution, abnormal ABO + MO1-gata2a + MO1-gata3 standard conditions Fig. 5 with image from Gerber et al., 2019
spinal cord sox1b expression decreased distribution, abnormal ABO + MO1-gata2a + MO1-gata3 standard conditions Fig. 5 with image from Gerber et al., 2019
spinal cord gad1b expression decreased distribution, abnormal ABO + MO1-gata2a + MO1-gata3 standard conditions Fig. 5 with image from Gerber et al., 2019
Citations