Morpholino

MO1-ehmt2

ID
ZDB-MRPHLNO-100524-9
Name
MO1-ehmt2
Previous Names
  • g9a MO1 (1)
Target
Sequence
5' - GACACACACTGACCTGCAGATGATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ehmt2
No data available
Phenotype
Phenotype resulting from MO1-ehmt2
Phenotype Fish Figures
amacrine cell ab1-gaba labeling absent, abnormal AB + MO1-ehmt2 Fig. S4 with image from Olsen et al., 2016
brain decreased size, abnormal WT + MO1-ehmt2 Fig. 6 with image from Rai et al., 2010
eye decreased size, abnormal AB + MO1-ehmt2 Fig. 2 with imageFig. S2 with image from Olsen et al., 2016
histone H3K9 monomethyltransferase activity disrupted, abnormal WT + MO1-ehmt2 Fig. 8 with image from Rai et al., 2010
midbrain lef1 expression decreased amount, abnormal AB + MO1-ehmt2 Fig. S3 with image from Olsen et al., 2016
midbrain morphology, abnormal AB + MO1-ehmt2 Fig. 2 with imageFig. S2 with image from Olsen et al., 2016
midbrain apoptotic process increased occurrence, abnormal AB + MO1-ehmt2 Fig. 7 with image from Olsen et al., 2016
pericardium edematous, abnormal WT + MO1-ehmt2 Fig. 6 with image from Rai et al., 2010
retina ab5-casp3 labeling increased amount, abnormal AB + MO1-ehmt2 Fig. 5 with image from Olsen et al., 2016
retina apoptotic process increased occurrence, abnormal AB + MO1-ehmt2 Fig. 5 with image from Olsen et al., 2016
retina apoptotic process process quality, ameliorated AB + MO1-ehmt2 + MO4-tp53 Fig. 5 with image from Olsen et al., 2016
retina cell population proliferation increased occurrence, abnormal AB + MO1-ehmt2 Fig. S4 with image from Olsen et al., 2016
retina nucleus Ab34-h3 labeling decreased amount, abnormal AB + MO1-ehmt2 Fig. S3 with image from Olsen et al., 2016
retinal bipolar neuron ab2-prkcb labeling absent, abnormal AB + MO1-ehmt2 Fig. S4 with image from Olsen et al., 2016
retinal cone cell zpr-1 labeling absent, abnormal AB + MO1-ehmt2 Fig. S4 with image from Olsen et al., 2016
Phenotype of all Fish created by or utilizing MO1-ehmt2
Phenotype Fish Conditions Figures
retinal bipolar neuron ab2-prkcb labeling absent, abnormal AB + MO1-ehmt2 standard conditions Fig. S4 with image from Olsen et al., 2016
midbrain lef1 expression decreased amount, abnormal AB + MO1-ehmt2 standard conditions Fig. S3 with image from Olsen et al., 2016
midbrain apoptotic process increased occurrence, abnormal AB + MO1-ehmt2 standard conditions Fig. 7 with image from Olsen et al., 2016
retina apoptotic process increased occurrence, abnormal AB + MO1-ehmt2 standard conditions Fig. 5 with image from Olsen et al., 2016
midbrain morphology, abnormal AB + MO1-ehmt2 standard conditions Fig. 2 with imageFig. S2 with image from Olsen et al., 2016
retina cell population proliferation increased occurrence, abnormal AB + MO1-ehmt2 standard conditions Fig. S4 with image from Olsen et al., 2016
retina nucleus Ab34-h3 labeling decreased amount, abnormal AB + MO1-ehmt2 standard conditions Fig. S3 with image from Olsen et al., 2016
retinal cone cell zpr-1 labeling absent, abnormal AB + MO1-ehmt2 standard conditions Fig. S4 with image from Olsen et al., 2016
retina ab5-casp3 labeling increased amount, abnormal AB + MO1-ehmt2 standard conditions Fig. 5 with image from Olsen et al., 2016
amacrine cell ab1-gaba labeling absent, abnormal AB + MO1-ehmt2 standard conditions Fig. S4 with image from Olsen et al., 2016
eye decreased size, abnormal AB + MO1-ehmt2 standard conditions Fig. 2 with imageFig. S2 with image from Olsen et al., 2016
retina apoptotic process process quality, ameliorated AB + MO1-ehmt2 + MO4-tp53 standard conditions Fig. 5 with image from Olsen et al., 2016
pericardium edematous, abnormal WT + MO1-ehmt2 standard conditions Fig. 6 with image from Rai et al., 2010
histone H3K9 monomethyltransferase activity disrupted, abnormal WT + MO1-ehmt2 standard conditions Fig. 8 with image from Rai et al., 2010
brain decreased size, abnormal WT + MO1-ehmt2 standard conditions Fig. 6 with image from Rai et al., 2010
retina central region vsx2 expression mislocalised, abnormal AB + MO1-ehmt2 + MO1-znf644a standard conditions Fig. 6 with image from Olsen et al., 2016
retina central region ccnd1 expression spatial pattern, abnormal AB + MO1-ehmt2 + MO1-znf644a standard conditions Fig. S6 with image from Olsen et al., 2016
midbrain ccnd1 expression mislocalised, abnormal AB + MO1-ehmt2 + MO1-znf644a standard conditions Fig. S6 with image from Olsen et al., 2016
midbrain ccnd1 expression spatial pattern, abnormal AB + MO1-ehmt2 + MO1-znf644a standard conditions Fig. S6 with image from Olsen et al., 2016
retina central region ccnd1 expression mislocalised, abnormal AB + MO1-ehmt2 + MO1-znf644a standard conditions Fig. S6 with image from Olsen et al., 2016
retina cell population proliferation increased occurrence, abnormal AB + MO1-ehmt2 + MO1-znf644a standard conditions Fig. 6 with imageFig. S6 with image from Olsen et al., 2016
retina apoptotic process increased occurrence, abnormal AB + MO1-ehmt2 + MO1-znf644b standard conditions Fig. 6 with image from Olsen et al., 2016
retina central region vsx2 expression mislocalised, abnormal AB + MO1-ehmt2 + MO1-znf644b standard conditions Fig. 6 with image from Olsen et al., 2016
midbrain ccnd1 expression mislocalised, abnormal AB + MO1-ehmt2 + MO1-znf644b standard conditions Fig. S6 with image from Olsen et al., 2016
midbrain ccnd1 expression spatial pattern, abnormal AB + MO1-ehmt2 + MO1-znf644b standard conditions Fig. S6 with image from Olsen et al., 2016
retina central region ccnd1 expression spatial pattern, abnormal AB + MO1-ehmt2 + MO1-znf644b standard conditions Fig. S6 with image from Olsen et al., 2016
retina central region ccnd1 expression mislocalised, abnormal AB + MO1-ehmt2 + MO1-znf644b standard conditions Fig. S6 with image from Olsen et al., 2016
retina cell population proliferation increased occurrence, abnormal AB + MO1-ehmt2 + MO1-znf644b standard conditions Fig. 6 with imageFig. S6 with image from Olsen et al., 2016
retina ab5-casp3 labeling increased amount, abnormal AB + MO1-ehmt2 + MO1-znf644b standard conditions Fig. 6 with image from Olsen et al., 2016
Citations