Morpholino

MO3-lrrk2

ID
ZDB-MRPHLNO-100520-6
Name
MO3-lrrk2
Previous Names
None
Target
Sequence
5' - ACAACTCCTCTATTTCTGCCATGAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
targeted to translation-start
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-lrrk2
No data available
Phenotype
Phenotype resulting from MO3-lrrk2
Phenotype Fish Figures
brain lrrk2 expression decreased amount, abnormal AB + MO3-lrrk2 Fig. 6 with image from Prabhudesai et al., 2016
brain has fewer parts of type dopaminergic neuron, abnormal AB + MO3-lrrk2 Fig. 5 with image from Prabhudesai et al., 2016
brain has fewer parts of type neuron, abnormal AB + MO3-lrrk2 Fig. 5 with image from Prabhudesai et al., 2016
diencephalon Ab3-sncb labeling increased amount, abnormal AB + MO3-lrrk2 Fig. 8 with image from Prabhudesai et al., 2016
eye decreased size, abnormal AB + MO3-lrrk2 Fig. 1 with image from Prabhudesai et al., 2016
eye edematous, abnormal AB + MO3-lrrk2 + MO4-tp53 Fig. 3 with image from Prabhudesai et al., 2016
eye malformed, abnormal AB + MO3-lrrk2 Fig. 1 with image from Prabhudesai et al., 2016
hindbrain Ab3-sncb labeling increased amount, abnormal AB + MO3-lrrk2 Fig. 8 with image from Prabhudesai et al., 2016
lens edematous, abnormal AB + MO3-lrrk2 Fig. 1 with image from Prabhudesai et al., 2016
midbrain Ab3-sncb labeling increased amount, abnormal AB + MO3-lrrk2 Fig. 8 with image from Prabhudesai et al., 2016
optic fissure open, abnormal AB + MO3-lrrk2 Fig. 1 with image from Prabhudesai et al., 2016
otic vesicle edematous, abnormal AB + MO3-lrrk2 Fig. 1 with image from Prabhudesai et al., 2016
post-vent region bent, abnormal AB + MO3-lrrk2 + MO4-tp53 Fig. 1 with imageFig. 3 with imageFig. 5 with image from Prabhudesai et al., 2016
post-vent region cell death increased occurrence, abnormal AB + MO3-lrrk2 Fig. 5 with image from Prabhudesai et al., 2016
postoptic commissure Ab3-sncb labeling increased amount, abnormal AB + MO3-lrrk2 Fig. 8 with image from Prabhudesai et al., 2016
pronephric duct apicolateral plasma membrane ab1-atp1a1 labeling mislocalised, abnormal AB + MO3-lrrk2 Fig. 9 with image from Prabhudesai et al., 2016
pronephric duct kidney epithelium development process quality, abnormal AB + MO3-lrrk2 Fig. 9 with image from Prabhudesai et al., 2016
spinal cord has fewer parts of type neuron, abnormal AB + MO3-lrrk2 Fig. 5 with image from Prabhudesai et al., 2016
whole organism lrrk2 expression decreased amount, abnormal AB + MO3-lrrk2 Fig. 1 with image from Prabhudesai et al., 2016
whole organism Ab3-sncb labeling increased amount, abnormal AB + MO3-lrrk2 Fig. 7 with image from Prabhudesai et al., 2016
whole organism sod1 expression increased amount, abnormal AB + MO3-lrrk2 Fig. 7 with image from Prabhudesai et al., 2016
whole organism Ab1-htra2 labeling increased amount, abnormal AB + MO3-lrrk2 Fig. 7 with image from Prabhudesai et al., 2016
Phenotype of all Fish created by or utilizing MO3-lrrk2
Phenotype Fish Conditions Figures
pronephric duct kidney epithelium development process quality, abnormal AB + MO3-lrrk2 standard conditions Fig. 9 with image from Prabhudesai et al., 2016
whole organism lrrk2 expression decreased amount, abnormal AB + MO3-lrrk2 standard conditions Fig. 1 with image from Prabhudesai et al., 2016
diencephalon Ab3-sncb labeling increased amount, abnormal AB + MO3-lrrk2 standard conditions Fig. 8 with image from Prabhudesai et al., 2016
otic vesicle edematous, abnormal AB + MO3-lrrk2 standard conditions Fig. 1 with image from Prabhudesai et al., 2016
whole organism Ab1-htra2 labeling increased amount, abnormal AB + MO3-lrrk2 standard conditions Fig. 7 with image from Prabhudesai et al., 2016
postoptic commissure Ab3-sncb labeling increased amount, abnormal AB + MO3-lrrk2 standard conditions Fig. 8 with image from Prabhudesai et al., 2016
pronephric duct apicolateral plasma membrane ab1-atp1a1 labeling mislocalised, abnormal AB + MO3-lrrk2 standard conditions Fig. 9 with image from Prabhudesai et al., 2016
eye malformed, abnormal AB + MO3-lrrk2 standard conditions Fig. 1 with image from Prabhudesai et al., 2016
midbrain Ab3-sncb labeling increased amount, abnormal AB + MO3-lrrk2 standard conditions Fig. 8 with image from Prabhudesai et al., 2016
whole organism Ab3-sncb labeling increased amount, abnormal AB + MO3-lrrk2 standard conditions Fig. 7 with image from Prabhudesai et al., 2016
lens edematous, abnormal AB + MO3-lrrk2 standard conditions Fig. 1 with image from Prabhudesai et al., 2016
brain lrrk2 expression decreased amount, abnormal AB + MO3-lrrk2 standard conditions Fig. 6 with image from Prabhudesai et al., 2016
whole organism sod1 expression increased amount, abnormal AB + MO3-lrrk2 standard conditions Fig. 7 with image from Prabhudesai et al., 2016
post-vent region cell death increased occurrence, abnormal AB + MO3-lrrk2 standard conditions Fig. 5 with image from Prabhudesai et al., 2016
spinal cord has fewer parts of type neuron, abnormal AB + MO3-lrrk2 standard conditions Fig. 5 with image from Prabhudesai et al., 2016
hindbrain Ab3-sncb labeling increased amount, abnormal AB + MO3-lrrk2 standard conditions Fig. 8 with image from Prabhudesai et al., 2016
brain has fewer parts of type neuron, abnormal AB + MO3-lrrk2 standard conditions Fig. 5 with image from Prabhudesai et al., 2016
post-vent region bent, abnormal AB + MO3-lrrk2 standard conditions Fig. 1 with imageFig. 5 with image from Prabhudesai et al., 2016
optic fissure open, abnormal AB + MO3-lrrk2 standard conditions Fig. 1 with image from Prabhudesai et al., 2016
brain has fewer parts of type dopaminergic neuron, abnormal AB + MO3-lrrk2 standard conditions Fig. 5 with image from Prabhudesai et al., 2016
eye decreased size, abnormal AB + MO3-lrrk2 standard conditions Fig. 1 with image from Prabhudesai et al., 2016
eye edematous, abnormal AB + MO3-lrrk2 + MO4-tp53 standard conditions Fig. 3 with image from Prabhudesai et al., 2016
post-vent region bent, abnormal AB + MO3-lrrk2 + MO4-tp53 standard conditions Fig. 3 with image from Prabhudesai et al., 2016
Citations