Morpholino

MO2-lfng

ID
ZDB-MRPHLNO-100510-10
Name
MO2-lfng
Previous Names
  • E1I1 MO (1)
Target
Sequence
5' - ACCGTGTATACCTGTCGCATGTTTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice blocking MO, targets exon 1/intron 1 boundary.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-lfng
Expressed Gene Anatomy Figures
ascl1a Fig. 2 with image,  Fig. S3 with image from Nikolaou et al., 2009
ascl1b Fig. 2 with image,  Fig. S3 with image from Nikolaou et al., 2009
dla Fig. 2 with image,  Fig. S3 with image from Nikolaou et al., 2009
dlb Fig. 2 with image,  Fig. S3 with image from Nikolaou et al., 2009
efnb3b Fig. S2 with image from Nikolaou et al., 2009
egr2a Fig. S2 with image,  Fig. S4 with image from Nikolaou et al., 2009
evx1 Fig. S4 with image from Nikolaou et al., 2009
foxb1a Fig. S2 with image from Nikolaou et al., 2009
gad1b Fig. S4 with image from Nikolaou et al., 2009
gata3 Fig. 5 with image from Nikolaou et al., 2009
her4.1 Fig. 4 with image,  Fig. S3 with image from Nikolaou et al., 2009
her12 Fig. 4 with image from Nikolaou et al., 2009
lhx2b Fig. S4 with image from Nikolaou et al., 2009
lhx9 Fig. S4 with image from Nikolaou et al., 2009
neurod4 Fig. 2 with image from Nikolaou et al., 2009
neurog1 Fig. 2 with image,  Fig. S3 with image from Nikolaou et al., 2009
pax2a Fig. S4 with image from Nikolaou et al., 2009
rfng Fig. S2 with image from Nikolaou et al., 2009
sox3 Fig. 4 with image,  Fig. S3 with image from Nikolaou et al., 2009
sox19a Fig. 4 with image from Nikolaou et al., 2009
tbx20 Fig. S4 with image from Nikolaou et al., 2009
vsx1 Fig. 5 with image from Nikolaou et al., 2009
Phenotype
Phenotype resulting from MO2-lfng
Phenotype Fish Figures
CiD increased amount, abnormal WT + MO2-lfng Fig. 5 with image from Nikolaou et al., 2009
facial nerve motor nucleus increased amount, abnormal WT + MO2-lfng Fig. S4 with image from Nikolaou et al., 2009
hindbrain interneuron increased amount, abnormal WT + MO2-lfng Fig. S4 with image from Nikolaou et al., 2009
trigeminal motor nucleus increased amount, abnormal WT + MO2-lfng Fig. S4 with image from Nikolaou et al., 2009
vagal lobe increased amount, abnormal WT + MO2-lfng Fig. S4 with image from Nikolaou et al., 2009
VeLD increased amount, abnormal WT + MO2-lfng Fig. 5 with image from Nikolaou et al., 2009
Phenotype of all Fish created by or utilizing MO2-lfng
Phenotype Fish Conditions Figures
facial nerve motor nucleus increased amount, abnormal WT + MO2-lfng standard conditions Fig. S4 with image from Nikolaou et al., 2009
VeLD increased amount, abnormal WT + MO2-lfng standard conditions Fig. 5 with image from Nikolaou et al., 2009
trigeminal motor nucleus increased amount, abnormal WT + MO2-lfng standard conditions Fig. S4 with image from Nikolaou et al., 2009
fin regeneration decreased process quality, abnormal WT + MO2-lfng physical alteration: anatomical structure Fig. 3 with image from Münch et al., 2013
hindbrain interneuron increased amount, abnormal WT + MO2-lfng standard conditions Fig. S4 with image from Nikolaou et al., 2009
CiD increased amount, abnormal WT + MO2-lfng standard conditions Fig. 5 with image from Nikolaou et al., 2009
vagal lobe increased amount, abnormal WT + MO2-lfng standard conditions Fig. S4 with image from Nikolaou et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.