Morpholino

MO1-dmbx1a

ID
ZDB-MRPHLNO-100412-1
Name
MO1-dmbx1a
Previous Names
  • mbx-MO (1)
Target
Sequence
5' - ACTCCGTAGTGCTGCATGATTCACA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dmbx1a
Phenotype
Phenotype resulting from MO1-dmbx1a
Phenotype of all Fish created by or utilizing MO1-dmbx1a
Phenotype Fish Conditions Figures
lens decreased size, abnormal AB + MO1-dmbx1a standard conditions Fig. 5 with image from Wong et al., 2010
retina development in camera-type eye disrupted, abnormal AB + MO1-dmbx1a standard conditions Fig. 5 with image from Wong et al., 2010
lens fiber cell differentiation disrupted, abnormal AB + MO1-dmbx1a standard conditions Fig. 5 with image from Wong et al., 2010
retina decreased thickness, abnormal AB + MO1-dmbx1a standard conditions Fig. 5 with image from Wong et al., 2010
optic tectum decreased size, abnormal AB + MO1-dmbx1a standard conditions Fig. 3 with image from Wong et al., 2010
retina layer formation disrupted, abnormal AB + MO1-dmbx1a standard conditions Fig. 5 with image from Wong et al., 2010
cranial nerve II defasciculated, abnormal zc7Tg + MO1-dmbx1a standard conditions Fig. S4 with image from Wong et al., 2010
amacrine cell absent, abnormal AB + MO1-dmbx1a + MO1-dmbx1b standard conditions Fig. 8 with image from Wong et al., 2015
retina central region ccnd1 expression increased amount, abnormal AB + MO1-dmbx1a + MO1-dmbx1b standard conditions Fig. 7 with image from Wong et al., 2015
cell population proliferation disrupted, abnormal AB + MO1-dmbx1a + MO1-dmbx1b standard conditions Fig. 7 with image from Wong et al., 2010
retina decreased thickness, abnormal AB + MO1-dmbx1a + MO1-dmbx1b standard conditions Fig. 5 with image from Wong et al., 2010
retina layer formation disrupted, abnormal AB + MO1-dmbx1a + MO1-dmbx1b standard conditions Fig. 5 with image from Wong et al., 2010
retina development in camera-type eye disrupted, abnormal AB + MO1-dmbx1a + MO1-dmbx1b standard conditions Fig. 5 with image from Wong et al., 2010
cell cycle increased duration, abnormal AB + MO1-dmbx1a + MO1-dmbx1b standard conditions Fig. 8 with image from Wong et al., 2010
head vsx2 expression increased amount, abnormal AB + MO1-dmbx1a + MO1-dmbx1b standard conditions Fig. 2 with image from Wong et al., 2015
retinal cone cell decreased amount, abnormal AB + MO1-dmbx1a + MO1-dmbx1b standard conditions Fig. 8 with image from Wong et al., 2015
retina peripheral region ccnd1 expression increased amount, abnormal AB + MO1-dmbx1a + MO1-dmbx1b standard conditions Fig. 7 with image from Wong et al., 2015
lens decreased size, abnormal AB + MO1-dmbx1a + MO1-dmbx1b standard conditions Fig. 5 with image from Wong et al., 2010
retina ccnd1 expression increased amount, abnormal AB + MO1-dmbx1a + MO1-dmbx1b standard conditions Fig. 7 with image from Wong et al., 2015
lens fiber cell differentiation disrupted, abnormal AB + MO1-dmbx1a + MO1-dmbx1b standard conditions Fig. 5 with image from Wong et al., 2010
retina central region vsx2 expression increased amount, abnormal AB + MO1-dmbx1a + MO1-dmbx1b standard conditions Fig. 2 with image from Wong et al., 2015
optic tectum morphology, abnormal AB + MO1-dmbx1a + MO1-dmbx1b standard conditions Fig. 3 with image from Wong et al., 2010
amacrine cell decreased amount, abnormal AB + MO1-dmbx1a + MO1-dmbx1b standard conditions Fig. 8 with image from Wong et al., 2015
retinal cone cell absent, abnormal AB + MO1-dmbx1a + MO1-dmbx1b standard conditions Fig. 8 with image from Wong et al., 2015
retinal cone cell amount, ameliorated AB + MO1-ccnd1 + MO1-dmbx1a + MO1-dmbx1b standard conditions Fig. 8 with image from Wong et al., 2015
retina zpr-1 labeling absent, abnormal AB + MO1-ccnd1 + MO1-dmbx1a + MO1-dmbx1b standard conditions Fig. 8 with image from Wong et al., 2015
amacrine cell amount, ameliorated AB + MO1-ccnd1 + MO1-dmbx1a + MO1-dmbx1b standard conditions Fig. 8 with image from Wong et al., 2015
retinal ganglion cell absent, ameliorated pd1Tg + MO1-dmbx1a control Fig. 6 with image from Wong et al., 2015
retina vsx2 expression increased amount, abnormal pd1Tg + MO1-dmbx1a control Fig. 6 with image from Wong et al., 2015
retina zn-5 labeling absent, abnormal pd1Tg + MO1-dmbx1a control Fig. 6 with image from Wong et al., 2015
retina central region vsx2 expression increased amount, abnormal pd1Tg + MO1-dmbx1a control Fig. 6 with image from Wong et al., 2015
retinal ganglion cell amount, ameliorated pd1Tg + MO1-dmbx1a heat shock Fig. 6 with image from Wong et al., 2015
retinal ganglion cell decreased amount, abnormal pd1Tg + MO1-dmbx1a control Fig. 6 with image from Wong et al., 2015
retina central region vsx2 expression amount, ameliorated pd1Tg + MO1-dmbx1a heat shock Fig. 6 with image from Wong et al., 2015
amacrine cell decreased amount, abnormal zc7Tg + MO1-dmbx1a + MO1-dmbx1b standard conditions Fig. 6 with image from Wong et al., 2010
retina neuronal stem cell undifferentiated, abnormal zc7Tg + MO1-dmbx1a + MO1-dmbx1b standard conditions Fig. 6 with image from Wong et al., 2010
retinal ganglion cell decreased amount, abnormal zc7Tg + MO1-dmbx1a + MO1-dmbx1b standard conditions Fig. 6 with image from Wong et al., 2010
retinal bipolar neuron decreased amount, abnormal zc7Tg + MO1-dmbx1a + MO1-dmbx1b standard conditions Fig. 6 with image from Wong et al., 2010
Citations