ZFIN ID: ZDB-MRPHLNO-100308-3
Morpholino Name: MO1-grk5
Target: grk5 (1)
Previous Name: zGRK5 MO1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCGCTGCCATTGTTTCGATCTCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-grk5 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-grk5
Expressed Gene Anatomy Figures
axin2 Fig. 4 from Chen et al., 2009
cdh5 Fig. 6 from Philipp et al., 2014
cdx4 Fig. 5 from Chen et al., 2009
ctnnb1 Fig. 4 from Chen et al., 2009
efnb2a Fig. 6 from Philipp et al., 2014
flt4 Fig. 6 from Philipp et al., 2014
grk5 Fig. 4 from Chen et al., 2009
myh6 Fig. 1 from Philipp et al., 2014
myh7 Fig. 1Fig. 9 from Philipp et al., 2014
myl7 Fig. 1Fig. 9 from Philipp et al., 2014
nkx2.2a Fig. 11 from Philipp et al., 2014
nkx2.5 Fig. 9 from Philipp et al., 2014
ptch2 Fig. 11 from Philipp et al., 2014
vent Fig. 5 from Chen et al., 2009
PHENOTYPE
Phenotype resulting from MO1-grk5
Phenotype of all Fish created by or utilizing MO1-grk5
Genome Resources:
CITATIONS (3)