Morpholino

MO1-gnb1a

ID
ZDB-MRPHLNO-091119-3
Name
MO1-gnb1a
Previous Names
  • MO1-gnb1 (1)
Target
Sequence
5' - CTGGTCGAGTTCGCTCATTTTCTTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a translation blocking morpholino.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gnb1a
No data available
Phenotype
Phenotype resulting from MO1-gnb1a
No data available
Phenotype of all Fish created by or utilizing MO1-gnb1a
Phenotype Fish Conditions Figures
pericardium edematous, abnormal WT + MO1-gnb1a + MO1-gnb1b control Fig. 1 from Hippe et al., 2011
heart contraction process quality, abnormal WT + MO1-gnb1a + MO1-gnb1b control Fig. 1 from Hippe et al., 2011
heart decreased functionality, abnormal WT + MO1-gnb1a + MO1-gnb1b standard conditions Fig. 4 with image from Hippe et al., 2009
heart decreased contractility, abnormal WT + MO1-gnb1a + MO1-gnb1b standard conditions Fig. 4 with image from Hippe et al., 2009
heart contraction decreased rate, abnormal WT + MO1-gnb1a + MO1-gnb1b standard conditions Fig. 4 with image from Hippe et al., 2009
GTP biosynthetic process decreased rate, abnormal WT + MO1-gnb1a + MO1-gnb1b standard conditions Fig. 3 with image from Hippe et al., 2009
whole organism ab1-gnb labeling decreased amount, abnormal WT + MO1-gnb1a + MO1-gnb1b control Fig. 1 from Hippe et al., 2011
neutrophil GFP expression spatial pattern, abnormal e114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 amputation: caudal fin Fig. 7 with image from Ke et al., 2017
neutrophil GFP expression spatial pattern, abnormal e116Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 amputation: caudal fin Fig. 8 with image from Ke et al., 2017
heart composition, abnormal f1Tg + MO1-gnb1a + MO1-gnb1b standard conditions Fig. 5 with image from Hippe et al., 2009
cAMP biosynthetic process decreased rate, abnormal f1Tg + MO1-gnb1a + MO1-gnb1b standard conditions Fig. 5 with image from Hippe et al., 2009
neutrophil chemotaxis decreased process quality, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 5 with image from Ke et al., 2017
neutrophil ab1-gnb1a labeling decreased amount, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 2 with image from Ke et al., 2017
neutrophil migration decreased occurrence, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 amputation: caudal fin Fig. 3 with image from Ke et al., 2017
neutrophil chemotaxis decreased occurrence, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 amputation: caudal fin Fig. 3 with image from Ke et al., 2017
neutrophil migration process quality, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 5 with image from Ke et al., 2017
neutrophil migration decreased process quality, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 5 with image from Ke et al., 2017
neutrophil migration process quality, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 amputation: caudal fin Fig. 3 with image from Ke et al., 2017
neutrophil activation decreased process quality, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 5 with image from Ke et al., 2017
neutrophil migration decreased process quality, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 amputation: caudal fin Fig. 3 with image from Ke et al., 2017
neutrophil chemotaxis decreased occurrence, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 5 with image from Ke et al., 2017
neutrophil chemotaxis decreased process quality, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 amputation: caudal fin Fig. 3 with image from Ke et al., 2017
neutrophil activation decreased occurrence, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 5 with image from Ke et al., 2017
neutrophil morphology, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 5 with image from Ke et al., 2017
neutrophil ab1-gnb labeling decreased amount, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 2 with image from Ke et al., 2017
neutrophil ab1-gnb1a labeling decreased amount, abnormal i114Tg + MO1-gnb1a + MO1-gnb4a + MO1-gnb4b + MO2-gnb1b + MO4-tp53 control Fig. 2 with image from Ke et al., 2017
neutrophil ab1-gnb labeling decreased amount, abnormal i114Tg + MO1-gnb1a + MO1-gnb4a + MO1-gnb4b + MO2-gnb1b + MO4-tp53 control Fig. 2 with image from Ke et al., 2017
Citations