header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-090924-1
Morpholino Name: MO1-stc1l
Target: stc1l (1)
Previous Names: MO1-stc1, zSTC-1-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AAATCCGCTTTTCAGGAGCATGTCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-stc1l No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-stc1l
Expressed Gene Anatomy Figures
fgf23 Fig. 7 from Lin et al., 2017
foxi3a Fig. 5 from Chou et al., 2015
stc1l Fig. 5 from Tseng et al., 2009
PHENOTYPE
Phenotype resulting from MO1-stc1l
Phenotype of all Fish created by or utilizing MO1-stc1l
Phenotype Fish Conditions Figures
whole organism fgf23 expression increased amount, abnormal AB + MO1-stc1l standard conditions Fig. 7 from Lin et al., 2017
NCC ionocyte increased amount, abnormal WT + MO1-stc1l standard conditions Fig. 4 from Chou et al., 2015
calcium ion import increased rate, abnormal WT + MO1-stc1l standard conditions Fig. 5 from Tseng et al., 2009
skin development cellular spatiotemporal quality, abnormal WT + MO1-stc1l standard conditions Fig. 4 from Chou et al., 2015
epidermis multi fate stem cell normal amount, abnormal WT + MO1-stc1l standard conditions Fig. 6 from Chou et al., 2015
vH ionocyte increased amount, abnormal WT + MO1-stc1l standard conditions Fig. 4 from Chou et al., 2015
NaK ionocyte increased amount, abnormal WT + MO1-stc1l standard conditions Fig. 4 from Chou et al., 2015
integument foxi3a expression increased amount, abnormal WT + MO1-stc1l standard conditions Fig. 5 from Chou et al., 2015
whole organism fgf23 expression decreased amount, abnormal AB + MO1-stc1l + MO3-casr standard conditions Fig. 8 from Lin et al., 2017
calcium ion import increased occurrence, abnormal AB + MO1-stc1l + MO3-casr standard conditions Fig. 8 from Lin et al., 2017
whole organism trpv6 expression increased amount, abnormal AB + MO1-stc1l + MO3-casr standard conditions Fig. 8 from Lin et al., 2017
whole organism trpv6 expression increased amount, abnormal AB + MO1-stc1l + MO3-casr high calcium Fig. 8 from Lin et al., 2017
whole organism fgf23 expression decreased amount, abnormal AB + MO1-stc1l + MO3-casr high calcium Fig. 8 from Lin et al., 2017
calcium ion import increased occurrence, abnormal AB + MO1-stc1l + MO3-casr high calcium Fig. 8 from Lin et al., 2017
Genome Resources:
CITATIONS (3)