Morpholino

MO1-stc1l

ID

ZDB-MRPHLNO-090924-1

Name

MO1-stc1l

Previous Names

MO1-stc1
zSTC-1-MO (1)

Target

stc1l (1)

Sequence

5' - AAATCCGCTTTTCAGGAGCATGTCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-stc1l

Expressed Gene	Anatomy	Figures
fgf23	whole organism	Fig. 7 from Lin et al., 2017
foxi3a	integument	Fig. 5 from Chou et al., 2015
stc1l	(not) corpuscles of Stannius	Fig. 5 from Tseng et al., 2009

Phenotype

Phenotype resulting from MO1-stc1l

Phenotype	Fish	Figures
calcium ion import increased rate, abnormal	WT + MO1-stc1l	Fig. 5 from Tseng et al., 2009
integument foxi3a expression increased amount, abnormal	WT + MO1-stc1l	Fig. 5 from Chou et al., 2015
NaK ionocyte increased amount, abnormal	WT + MO1-stc1l	Fig. 4 from Chou et al., 2015
NCC ionocyte increased amount, abnormal	WT + MO1-stc1l	Fig. 4 from Chou et al., 2015
skin development cellular spatiotemporal quality, abnormal	WT + MO1-stc1l	Fig. 4 from Chou et al., 2015
vH ionocyte increased amount, abnormal	WT + MO1-stc1l	Fig. 4 from Chou et al., 2015
whole organism fgf23 expression increased amount, abnormal	AB + MO1-stc1l	Fig. 7 from Lin et al., 2017

Phenotype of all Fish created by or utilizing MO1-stc1l

Phenotype	Fish	Conditions	Figures
whole organism fgf23 expression increased amount, abnormal	AB + MO1-stc1l	standard conditions	Fig. 7 from Lin et al., 2017
calcium ion import increased rate, abnormal	WT + MO1-stc1l	standard conditions	Fig. 5 from Tseng et al., 2009
NCC ionocyte increased amount, abnormal	WT + MO1-stc1l	standard conditions	Fig. 4 from Chou et al., 2015
skin development cellular spatiotemporal quality, abnormal	WT + MO1-stc1l	standard conditions	Fig. 4 from Chou et al., 2015
vH ionocyte increased amount, abnormal	WT + MO1-stc1l	standard conditions	Fig. 4 from Chou et al., 2015
NaK ionocyte increased amount, abnormal	WT + MO1-stc1l	standard conditions	Fig. 4 from Chou et al., 2015
integument foxi3a expression increased amount, abnormal	WT + MO1-stc1l	standard conditions	Fig. 5 from Chou et al., 2015
whole organism fgf23 expression decreased amount, abnormal	AB + MO1-stc1l + MO3-casr	standard conditions	Fig. 8 from Lin et al., 2017
calcium ion import increased occurrence, abnormal	AB + MO1-stc1l + MO3-casr	standard conditions	Fig. 8 from Lin et al., 2017
whole organism trpv6 expression increased amount, abnormal	AB + MO1-stc1l + MO3-casr	standard conditions	Fig. 8 from Lin et al., 2017
whole organism trpv6 expression increased amount, abnormal	AB + MO1-stc1l + MO3-casr	high calcium	Fig. 8 from Lin et al., 2017
whole organism fgf23 expression decreased amount, abnormal	AB + MO1-stc1l + MO3-casr	high calcium	Fig. 8 from Lin et al., 2017
calcium ion import increased occurrence, abnormal	AB + MO1-stc1l + MO3-casr	high calcium	Fig. 8 from Lin et al., 2017

Citations