Morpholino

MO1-rargb

ID
ZDB-MRPHLNO-090825-4
Name
MO1-rargb
Previous Names
None
Target
Sequence
5' - CGTCTCTCATACCAAGTGGGCTGTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rargb
No data available
Phenotype
Phenotype resulting from MO1-rargb
Phenotype of all Fish created by or utilizing MO1-rargb
Phenotype Fish Conditions Figures
presumptive cardiac ventricle heart tube mislocalised, abnormal WT + MO1-rargb standard conditions Fig. 5 with image from Garnaas et al., 2012
spleen agenesis, abnormal WT + MO1-rargb standard conditions Fig. 7 with image from Garnaas et al., 2012
determination of liver left/right asymmetry disrupted, abnormal WT + MO1-rargb standard conditions Fig. 4 with image from Garnaas et al., 2012
determination of heart left/right asymmetry disrupted, abnormal WT + MO1-rargb standard conditions Fig. 5 with image from Garnaas et al., 2012
determination of intestine left/right asymmetry disrupted, abnormal WT + MO1-rargb standard conditions Fig. 4 with image from Garnaas et al., 2012
liver bilateral, abnormal WT + MO1-rargb standard conditions Fig. 3 with image from Garnaas et al., 2012
spleen decreased size, abnormal WT + MO1-rargb standard conditions Fig. 7 with image from Garnaas et al., 2012
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO1-rargb standard conditions Fig. 4 with image from Garnaas et al., 2012
determination of heart left/right asymmetry disrupted, abnormal pt510Tg + MO1-rargb standard conditions Fig. 6 with image from Garnaas et al., 2012
intrahepatic bile duct cell body increased size, abnormal um14Tg + MO1-rargb standard conditions Fig. 7 with image from Garnaas et al., 2012
intrahepatic bile duct decreased branchiness, abnormal um14Tg + MO1-rargb standard conditions Fig. 7 with image from Garnaas et al., 2012
intrahepatic bile duct development disrupted, abnormal um14Tg + MO1-rargb standard conditions Fig. 7 with image from Garnaas et al., 2012
intrahepatic bile duct morphology, abnormal um14Tg + MO1-rargb standard conditions Fig. 7 with image from Garnaas et al., 2012
hepatocyte increased amount, abnormal zf235Tg + MO1-rargb standard conditions Fig. 3 with image from Garnaas et al., 2012
pharyngeal arch 5 immature, abnormal WT + MO1-rarga + MO1-rargb + MO1-tp53 standard conditions Fig. 4 with image from Linville et al., 2009
liver absent, abnormal WT + MO1-raraa + MO1-rarab + MO1-rarga + MO1-rargb standard conditions Fig. 3 with image from Garnaas et al., 2012
liver decreased size, abnormal WT + MO1-raraa + MO1-rarab + MO1-rarga + MO1-rargb standard conditions Fig. 3 with image from Garnaas et al., 2012
hepatocyte decreased amount, abnormal zf235Tg + MO1-raraa + MO1-rarab + MO1-rarga + MO1-rargb standard conditions Fig. 3 with image from Garnaas et al., 2012
Citations