Morpholino

MO1-gad1b

ID
ZDB-MRPHLNO-090707-2
Name
MO1-gad1b
Previous Names
  • gad1MO (1)
  • MO1-gad1
Target
Sequence
5' - AAGGTGCAGAAGACGCCATCAGTCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gad1b
No data available
Phenotype
Phenotype resulting from MO1-gad1b
Phenotype Fish Figures
basihyal cartilage asymmetrical, abnormal WIK + MO1-gad1b Fig. 7 with image from O'Connor et al., 2018
basihyal cartilage determination of left/right symmetry disrupted, abnormal WIK + MO1-gad1b Fig. 7 with image from O'Connor et al., 2018
brain anterior region tfap2a expression decreased distribution, abnormal WIK + MO1-gad1b Fig. S22 from O'Connor et al., 2018
chondrocranium decreased size, abnormal WIK + MO1-gad1b Fig. 7 with image from O'Connor et al., 2018
cranial neural crest snai1b expression increased distribution, abnormal WIK + MO1-gad1b Fig. S22 from O'Connor et al., 2018
cranial neural crest foxd3 expression increased distribution, abnormal WIK + MO1-gad1b Fig. S22 from O'Connor et al., 2018
ethmoid cartilage bilateral symmetry, abnormal WIK + MO1-gad1b Fig. 7 with image from O'Connor et al., 2018
hindbrain morphology, abnormal WIK + MO1-gad1b Fig. 5 with image from O'Connor et al., 2018
Meckel's cartilage decreased length, abnormal WIK + MO1-gad1b Fig. 7 with image from O'Connor et al., 2018
Meckel's cartilage chondrocyte crowded, abnormal WIK + MO1-gad1b Fig. 7 with image from O'Connor et al., 2018
Meckel's cartilage chondrocyte mislocalised, abnormal WIK + MO1-gad1b Fig. 7 with image from O'Connor et al., 2018
Meckel's cartilage chondrocyte morphogenesis disrupted, abnormal WIK + MO1-gad1b Fig. 7 with image from O'Connor et al., 2018
midbrain morphology, abnormal WIK + MO1-gad1b Fig. 5 with image from O'Connor et al., 2018
neurocranial trabecula decreased length, abnormal WIK + MO1-gad1b Fig. 7 with image from O'Connor et al., 2018
optic tectum transmission of nerve impulse occurrence, abnormal WIK + MO1-gad1b Fig. S26 from O'Connor et al., 2018
oral region head mesenchyme spatial pattern, abnormal WIK + MO1-gad1b Fig. 5 with image from O'Connor et al., 2018
ventral mandibular arch decreased size, abnormal WIK + MO1-gad1b Fig. 6 with image from O'Connor et al., 2018
Phenotype of all Fish created by or utilizing MO1-gad1b
Phenotype Fish Conditions Figures
ventral mandibular arch decreased size, abnormal WIK + MO1-gad1b standard conditions Fig. 6 with image from O'Connor et al., 2018
Meckel's cartilage decreased length, abnormal WIK + MO1-gad1b standard conditions Fig. 7 with image from O'Connor et al., 2018
Meckel's cartilage chondrocyte mislocalised, abnormal WIK + MO1-gad1b standard conditions Fig. 7 with image from O'Connor et al., 2018
cranial neural crest snai1b expression increased distribution, abnormal WIK + MO1-gad1b standard conditions Fig. S22 from O'Connor et al., 2018
neurocranial trabecula decreased length, abnormal WIK + MO1-gad1b standard conditions Fig. 7 with image from O'Connor et al., 2018
ethmoid cartilage bilateral symmetry, abnormal WIK + MO1-gad1b standard conditions Fig. 7 with image from O'Connor et al., 2018
Meckel's cartilage chondrocyte morphogenesis disrupted, abnormal WIK + MO1-gad1b standard conditions Fig. 7 with image from O'Connor et al., 2018
optic tectum transmission of nerve impulse occurrence, abnormal WIK + MO1-gad1b standard conditions Fig. S26 from O'Connor et al., 2018
cranial neural crest foxd3 expression increased distribution, abnormal WIK + MO1-gad1b standard conditions Fig. S22 from O'Connor et al., 2018
hindbrain morphology, abnormal WIK + MO1-gad1b standard conditions Fig. 5 with image from O'Connor et al., 2018
basihyal cartilage determination of left/right symmetry disrupted, abnormal WIK + MO1-gad1b standard conditions Fig. 7 with image from O'Connor et al., 2018
basihyal cartilage asymmetrical, abnormal WIK + MO1-gad1b standard conditions Fig. 7 with image from O'Connor et al., 2018
midbrain morphology, abnormal WIK + MO1-gad1b standard conditions Fig. 5 with image from O'Connor et al., 2018
chondrocranium decreased size, abnormal WIK + MO1-gad1b standard conditions Fig. 7 with image from O'Connor et al., 2018
oral region head mesenchyme spatial pattern, abnormal WIK + MO1-gad1b standard conditions Fig. 5 with image from O'Connor et al., 2018
Meckel's cartilage chondrocyte crowded, abnormal WIK + MO1-gad1b standard conditions Fig. 7 with image from O'Connor et al., 2018
brain anterior region tfap2a expression decreased distribution, abnormal WIK + MO1-gad1b standard conditions Fig. S22 from O'Connor et al., 2018
optic tectum transmission of nerve impulse occurrence, exacerbated WIK + MO1-gad1b + MO1-gad2 standard conditions Fig. S26 from O'Connor et al., 2018
Citations