Morpholino

MO1-pdcd10a,pdcd10b

ID
ZDB-MRPHLNO-090625-1
Name
MO1-pdcd10a,pdcd10b
Previous Names
  • ccm3a/b-MO (1)
  • MO1-pdcd10a+pdcd10b
Targets
Sequence
5' - CTTCATCTCTTCCATTGTCATCCTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Start codon targeting MO
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pdcd10a,pdcd10b
No data available
Phenotype
Phenotype resulting from MO1-pdcd10a,pdcd10b
No data available
Phenotype of all Fish created by or utilizing MO1-pdcd10a,pdcd10b
Phenotype Fish Conditions Figures
blood circulation arrested, abnormal WT + MO1-pdcd10a,pdcd10b standard conditions Fig. S2 with image from Yoruk et al., 2012
heart looping arrested, abnormal WT + MO1-pdcd10a,pdcd10b standard conditions text only from Yoruk et al., 2012
heart contraction decreased rate, abnormal WT + MO1-pdcd10a,pdcd10b standard conditions text only from Voss et al., 2009
yolk ventral region edematous, abnormal WT + MO1-pdcd10a,pdcd10b standard conditions Fig. 1 with image from Yoruk et al., 2012
heart dilated, abnormal WT + MO1-pdcd10a,pdcd10b standard conditions Fig. 5text only from Voss et al., 2009
pericardium edematous, abnormal WT + MO1-pdcd10a,pdcd10b standard conditions Fig. 1 with imageFig. S2 with imagetext only from Yoruk et al., 2012
Fig. 5text only from Voss et al., 2009
heart shape, abnormal WT + MO1-pdcd10a,pdcd10b standard conditions text only from Yoruk et al., 2012
blood circulation disrupted, abnormal WT + MO1-pdcd10a,pdcd10b standard conditions Fig. 5text only from Voss et al., 2009
extension morphology, abnormal WT + MO1-pdcd10a,pdcd10b + MO2-stk25a standard conditions text only from Yoruk et al., 2012
post-vent region decreased length, abnormal WT + MO1-pdcd10a,pdcd10b + MO2-stk25a standard conditions text only from Yoruk et al., 2012
axis elongation arrested, abnormal WT + MO1-pdcd10a,pdcd10b + MO2-stk25a standard conditions text only from Yoruk et al., 2012
subintestinal vein disorganized, abnormal s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 5 from Voss et al., 2009
prosencephalic artery increased thickness, abnormal s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 2 with image from Yoruk et al., 2012
cranial vasculature dilated, abnormal s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 3 with imageFig. S2 with image from Yoruk et al., 2012
anterior cerebral vein increased thickness, abnormal s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 2 with image from Yoruk et al., 2012
subintestinal vein branched, abnormal s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 5 from Voss et al., 2009
caudal vein dilated, abnormal s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 5 from Voss et al., 2009
cranial vasculature attachment quality cranial vasculature, abnormal s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. S2 with image from Yoruk et al., 2012
mesencephalic vein unlumenized, abnormal s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. S3 with image from Yoruk et al., 2012
primordial midbrain channel increased size, abnormal s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. S1 with image from Yoruk et al., 2012
mid cerebral vein increased size, abnormal s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. S1 with image from Yoruk et al., 2012
cranial vasculature spatial pattern, abnormal s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 2 with imageFig. 3 with imageFig. S2 with image from Yoruk et al., 2012
anterior cerebral vein dilated, abnormal s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 2 with imageFig. 6 with image from Yoruk et al., 2012
heart dilated, abnormal s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 5 from Voss et al., 2009
blood circulation disrupted, abnormal s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 5 from Voss et al., 2009
prosencephalic artery dilated, abnormal s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 2 with imageFig. 6 with image from Yoruk et al., 2012
blood vessel endothelial cell cell projection increased length, abnormal s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 3 with image from Yoruk et al., 2012
blood vessel endothelial cell cell projection increased amount, abnormal s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 2 with imageFig. 3 with image from Yoruk et al., 2012
central artery hypoplastic, abnormal s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 2 with image from Yoruk et al., 2012
dorsal longitudinal anastomotic vessel increased width, abnormal s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 5 from Voss et al., 2009
brain vasculature morphology, abnormal s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 5 from Voss et al., 2009
cranial vasculature blood vessel endothelial cell disorganized, abnormal s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. S3 with image from Yoruk et al., 2012
mesencephalic vein increased thickness, abnormal s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 2 with image from Yoruk et al., 2012
mesencephalic vein dilated, abnormal s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 2 with imageFig. S3 with image from Yoruk et al., 2012
brain vasculature dilated, abnormal s843Tg + MO1-pdcd10a,pdcd10b standard conditions text only from Voss et al., 2009
intersegmental vessel increased width, abnormal s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 5 from Voss et al., 2009
posterior cardinal vein dilated, abnormal s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 5 from Voss et al., 2009
heart malformed, abnormal twu34Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 1 with image from Yoruk et al., 2012
heart looping arrested, abnormal twu34Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 1 with image from Yoruk et al., 2012
cranial vasculature dilated, abnormal y7Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. S3 with image from Yoruk et al., 2012
prosencephalic artery dilated, abnormal s843Tg + MO1-pdcd10a,pdcd10b + MO3-stk25b standard conditions Fig. 5 with image from Yoruk et al., 2012
mesencephalic vein dilated, abnormal s843Tg + MO1-pdcd10a,pdcd10b + MO3-stk25b standard conditions Fig. 5 with image from Yoruk et al., 2012
mesencephalic vein spatial pattern, abnormal s843Tg + MO1-pdcd10a,pdcd10b + MO3-stk25b standard conditions Fig. 5 with image from Yoruk et al., 2012
anterior cerebral vein dilated, abnormal s843Tg + MO1-pdcd10a,pdcd10b + MO3-stk25b standard conditions Fig. 5 with image from Yoruk et al., 2012
blood circulation arrested, abnormal s843Tg; sd2Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 1 with image from Yoruk et al., 2012
pericardium edematous, abnormal s843Tg; sd2Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 1 with image from Yoruk et al., 2012
yolk ventral region edematous, abnormal s843Tg; sd2Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 1 with image from Yoruk et al., 2012
blood vessel endothelial cell cell projection increased length, abnormal s896Tg; y7Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 2 with image from Yoruk et al., 2012
mesencephalic vein dilated, abnormal s896Tg; y7Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 2 with image from Yoruk et al., 2012
blood vessel endothelial cell cell projection increased amount, abnormal s896Tg; y7Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 2 with image from Yoruk et al., 2012
cranial vasculature spatial pattern, abnormal ccm2s259/s259; s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 7 with image from Yoruk et al., 2012
mesencephalic vein dilated, abnormal ccm2s259/s259; s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 7 with image from Yoruk et al., 2012
anterior cerebral vein dilated, abnormal ccm2s259/s259; s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 7 with image from Yoruk et al., 2012
prosencephalic artery dilated, abnormal ccm2s259/s259; s843Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 7 with image from Yoruk et al., 2012
aortic arch 1 decreased thickness, abnormal s843Tg; sd21Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 1 with image from Yoruk et al., 2012
aortic arch 1 obstructed, abnormal s843Tg; sd21Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 1 with image from Yoruk et al., 2012
blood circulation arrested, abnormal s843Tg; sd21Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 1 with image from Yoruk et al., 2012
ventral aorta decreased thickness, abnormal s843Tg; sd21Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 1 with image from Yoruk et al., 2012
ventral aorta obstructed, abnormal s843Tg; sd21Tg + MO1-pdcd10a,pdcd10b standard conditions Fig. 1 with image from Yoruk et al., 2012
Citations