Morpholino

MO1-rab11a

ID
ZDB-MRPHLNO-090617-5
Name
MO1-rab11a
Previous Names
  • SZ162 (1)
Target
Sequence
5' - GTATTCGTCGTCTCGTGTCCCCATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rab11a
No data available
Phenotype
Phenotype resulting from MO1-rab11a
Phenotype of all Fish created by or utilizing MO1-rab11a
Phenotype Fish Conditions Figures
melanosome transport decreased rate, abnormal WT + MO1-rab11a standard conditions Fig. S3 with image from Westlake et al., 2011
Kupffer's vesicle morphology, abnormal WT + MO1-rab11a standard conditions Fig. 3 with image from Westlake et al., 2011
cell death increased occurrence, abnormal WT + MO1-rab11a + MO2-rab11a standard conditions Fig. S4a with image from Kalén et al., 2009
head decreased size, abnormal WT + MO1-rab11a + MO2-rab11a standard conditions Fig. S4a with image from Kalén et al., 2009
intersegmental vessel decreased functionality, abnormal WT + MO1-rab11a + MO2-rab11a standard conditions Fig. S4a with image from Kalén et al., 2009
whole organism curved dorsal, abnormal WT + MO1-rab11a + MO2-rab11a standard conditions Fig. S4a with image from Kalén et al., 2009
eye decreased size, abnormal WT + MO1-rab11a + MO2-rab11a standard conditions Fig. S4a with image from Kalén et al., 2009
blood circulation disrupted, abnormal WT + MO1-rab11a + MO2-rab11a standard conditions Fig. S4a with image from Kalén et al., 2009
vasculature malformed, abnormal y1Tg + MO1-rab11a standard conditions Fig. 8 with image from Jopling et al., 2014
Kupffer's vesicle basolateral plasma membrane physical object quality, abnormal pt19Tg + MO1-llgl2 + MO1-rab11a standard conditions Fig. 6 with image from Tay et al., 2013
Kupffer's vesicle development decreased process quality, abnormal s870Tg + MO1-llgl2 + MO1-rab11a standard conditions Fig. 5 with image from Tay et al., 2013
Kupffer's vesicle decreased volume, abnormal s870Tg + MO1-llgl2 + MO1-rab11a standard conditions Fig. 5 with image from Tay et al., 2013
Citations