Morpholino

MO2-camk2b2

ID
ZDB-MRPHLNO-090608-2
Name
MO2-camk2b2
Previous Names
  • Camk2b2 MO B (1)
Target
Sequence
5' - GCGTGCAGGTTGTGGTTGCCATGTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-camk2b2
No data available
Phenotype
Phenotype resulting from MO2-camk2b2
Phenotype Fish Figures
calcium/calmodulin-dependent protein kinase activity decreased rate, abnormal WT + MO2-camk2b2 Fig. 3 with image from Francescatto et al., 2010
determination of digestive tract left/right asymmetry disrupted, abnormal WT + MO2-camk2b2 Fig. 3 with image from Francescatto et al., 2010
determination of left/right asymmetry in diencephalon disrupted, abnormal WT + MO2-camk2b2 Fig. 3 with image from Francescatto et al., 2010
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal WT + MO2-camk2b2 Fig. 6 with image from Francescatto et al., 2010
determination of liver left/right asymmetry disrupted, abnormal WT + MO2-camk2b2 Fig. 3 with image from Francescatto et al., 2010
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO2-camk2b2 Fig. 3 with image from Francescatto et al., 2010
digestive system centered, abnormal WT + MO2-camk2b2 Fig. 3 with image from Francescatto et al., 2010
digestive system inverted, abnormal WT + MO2-camk2b2 Fig. 3 with image from Francescatto et al., 2010
epithalamus aplastic, abnormal WT + MO2-camk2b2 Fig. 3 with image from Francescatto et al., 2010
epithalamus inverted, abnormal WT + MO2-camk2b2 Fig. 3 with image from Francescatto et al., 2010
head decreased size, abnormal WT + MO2-camk2b2 Fig. 2 with image from Rothschild et al., 2009
heart edematous, abnormal WT + MO2-camk2b2 Fig. 2 with imageFig. 3 with image from Rothschild et al., 2009
heart contraction decreased rate, abnormal WT + MO2-camk2b2 Fig. 2 with image from Rothschild et al., 2009
heart jogging disrupted, abnormal WT + MO2-camk2b2 Fig. 3 with image from Francescatto et al., 2010
heart looping arrested, abnormal WT + MO2-camk2b2 Fig. 2 with imageFig. 3 with image from Rothschild et al., 2009
heart tube centered, abnormal WT + MO2-camk2b2 Fig. 3 with image from Francescatto et al., 2010
heart tube inverted, abnormal WT + MO2-camk2b2 Fig. 3 with image from Francescatto et al., 2010
Kupffer's vesicle decreased size, abnormal WT + MO2-camk2b2 Fig. 5 with image from Francescatto et al., 2010
Kupffer's vesicle calcium- and calmodulin-dependent protein kinase complex mislocalised posteriorly, abnormal WT + MO2-camk2b2 Fig. 7 with image from Francescatto et al., 2010
Kupffer's vesicle cilium decreased amount, abnormal WT + MO2-camk2b2 Fig. 5 with image from Francescatto et al., 2010
Kupffer's vesicle cilium decreased length, abnormal WT + MO2-camk2b2 Fig. 5 with image from Francescatto et al., 2010
pectoral fin decreased length, abnormal WT + MO2-camk2b2 Fig. 3 with image from Rothschild et al., 2009
pectoral fin morphogenesis process quality, abnormal WT + MO2-camk2b2 Fig. 2 with image from Rothschild et al., 2009
somite malformed, abnormal WT + MO2-camk2b2 Fig. 2 with image from Rothschild et al., 2009
Phenotype of all Fish created by or utilizing MO2-camk2b2
Phenotype Fish Conditions Figures
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO2-camk2b2 standard conditions Fig. 3 with image from Francescatto et al., 2010
somite malformed, abnormal WT + MO2-camk2b2 standard conditions Fig. 2 with image from Rothschild et al., 2009
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal WT + MO2-camk2b2 standard conditions Fig. 6 with image from Francescatto et al., 2010
Kupffer's vesicle cilium decreased length, abnormal WT + MO2-camk2b2 standard conditions Fig. 5 with image from Francescatto et al., 2010
heart tube centered, abnormal WT + MO2-camk2b2 standard conditions Fig. 3 with image from Francescatto et al., 2010
heart edematous, abnormal WT + MO2-camk2b2 standard conditions Fig. 2 with imageFig. 3 with image from Rothschild et al., 2009
Kupffer's vesicle calcium- and calmodulin-dependent protein kinase complex mislocalised posteriorly, abnormal WT + MO2-camk2b2 standard conditions Fig. 7 with image from Francescatto et al., 2010
digestive system inverted, abnormal WT + MO2-camk2b2 standard conditions Fig. 3 with image from Francescatto et al., 2010
heart tube inverted, abnormal WT + MO2-camk2b2 standard conditions Fig. 3 with image from Francescatto et al., 2010
pectoral fin decreased length, abnormal WT + MO2-camk2b2 standard conditions Fig. 3 with image from Rothschild et al., 2009
calcium/calmodulin-dependent protein kinase activity decreased rate, abnormal WT + MO2-camk2b2 standard conditions Fig. 3 with image from Francescatto et al., 2010
heart jogging disrupted, abnormal WT + MO2-camk2b2 standard conditions Fig. 3 with image from Francescatto et al., 2010
determination of liver left/right asymmetry disrupted, abnormal WT + MO2-camk2b2 standard conditions Fig. 3 with image from Francescatto et al., 2010
Kupffer's vesicle cilium decreased amount, abnormal WT + MO2-camk2b2 standard conditions Fig. 5 with image from Francescatto et al., 2010
heart looping arrested, abnormal WT + MO2-camk2b2 standard conditions Fig. 2 with imageFig. 3 with image from Rothschild et al., 2009
determination of digestive tract left/right asymmetry disrupted, abnormal WT + MO2-camk2b2 standard conditions Fig. 3 with image from Francescatto et al., 2010
epithalamus aplastic, abnormal WT + MO2-camk2b2 standard conditions Fig. 3 with image from Francescatto et al., 2010
digestive system centered, abnormal WT + MO2-camk2b2 standard conditions Fig. 3 with image from Francescatto et al., 2010
epithalamus inverted, abnormal WT + MO2-camk2b2 standard conditions Fig. 3 with image from Francescatto et al., 2010
determination of left/right asymmetry in diencephalon disrupted, abnormal WT + MO2-camk2b2 standard conditions Fig. 3 with image from Francescatto et al., 2010
Kupffer's vesicle decreased size, abnormal WT + MO2-camk2b2 standard conditions Fig. 5 with image from Francescatto et al., 2010
heart contraction decreased rate, abnormal WT + MO2-camk2b2 standard conditions Fig. 2 with image from Rothschild et al., 2009
pectoral fin morphogenesis process quality, abnormal WT + MO2-camk2b2 standard conditions Fig. 2 with image from Rothschild et al., 2009
head decreased size, abnormal WT + MO2-camk2b2 standard conditions Fig. 2 with image from Rothschild et al., 2009
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal WT + MO2-camk2a + MO2-camk2b2 standard conditions Fig. 6 with image from Francescatto et al., 2010
Citations