Morpholino

MO2-ret

ID
ZDB-MRPHLNO-081020-2
Name
MO2-ret
Previous Names
  • MO2-ret1
Target
Sequence
5' - ACACGATTCCCCGCGTACTTCCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ret
Expressed Gene Anatomy Figures
dpysl3 Fig. 6 with image from Heanue et al., 2008
fgf13b Fig. 6 with image from Heanue et al., 2008
l1cama Fig. 6 with image from Heanue et al., 2008
l1camb Fig. 6 with image from Heanue et al., 2008
Phenotype
Phenotype resulting from MO2-ret
Phenotype Fish Figures
enteric nervous system l1camb expression absent, abnormal WT + MO2-ret Fig. 6 with image from Heanue et al., 2008
enteric nervous system fgf13b expression absent, abnormal WT + MO2-ret Fig. 6 with image from Heanue et al., 2008
enteric nervous system dpysl3 expression absent, abnormal WT + MO2-ret Fig. 6 with image from Heanue et al., 2008
enteric nervous system l1cama expression absent, abnormal WT + MO2-ret Fig. 6 with image from Heanue et al., 2008
enteric nervous system neuron absent, abnormal WT + MO2-ret Fig. 6 with image from Heanue et al., 2008
enteric nervous system neuron decreased amount, abnormal WT + MO2-ret Fig. 2 with image from Heanue et al., 2008
enteric nervous system development disrupted, abnormal WT + MO2-ret Fig. 2 with image,  Fig. 6 with image from Heanue et al., 2008
enteric neuron ab1-elavl labeling absent, abnormal WT + MO2-ret Fig. 2 with image from Heanue et al., 2008
enteric neuron decreased amount, abnormal WT + MO2-ret Fig. 3 from Jiang et al., 2015
gut distal region lacks all parts of type enteric neuron, abnormal WT + MO2-ret Fig. 3 with image from Heanue et al., 2008
gut enteric neuron decreased amount, abnormal AB + MO2-ret Fig. S7 from Tilghman et al., 2019
posterior intestine neuron absent, abnormal WT + MO2-ret Fig. 2 with image,  Fig. 6 with image from Heanue et al., 2008
posterior lateral line primordium neuron projection absent, abnormal rw0130aTg; ump1Tg + MO2-ret Fig. 2 with image from Schuster et al., 2010
Phenotype of all Fish created by or utilizing MO2-ret
Phenotype Fish Conditions Figures
gut enteric neuron decreased amount, abnormal AB + MO2-ret standard conditions Fig. S7 from Tilghman et al., 2019
enteric nervous system neuron absent, abnormal WT + MO2-ret standard conditions Fig. 6 with image from Heanue et al., 2008
enteric neuron ab1-elavl labeling absent, abnormal WT + MO2-ret standard conditions Fig. 2 with image from Heanue et al., 2008
enteric nervous system l1cama expression absent, abnormal WT + MO2-ret standard conditions Fig. 6 with image from Heanue et al., 2008
enteric nervous system neuron decreased amount, abnormal WT + MO2-ret standard conditions Fig. 2 with image from Heanue et al., 2008
enteric nervous system development disrupted, abnormal WT + MO2-ret standard conditions Fig. 2 with image,  Fig. 6 with image from Heanue et al., 2008
enteric nervous system dpysl3 expression absent, abnormal WT + MO2-ret standard conditions Fig. 6 with image from Heanue et al., 2008
posterior intestine neuron absent, abnormal WT + MO2-ret standard conditions Fig. 2 with image,  Fig. 6 with image from Heanue et al., 2008
gut distal region lacks all parts of type enteric neuron, abnormal WT + MO2-ret standard conditions Fig. 3 with image from Heanue et al., 2008
enteric nervous system l1camb expression absent, abnormal WT + MO2-ret standard conditions Fig. 6 with image from Heanue et al., 2008
enteric neuron decreased amount, abnormal WT + MO2-ret standard conditions Fig. 3 from Jiang et al., 2015
enteric nervous system fgf13b expression absent, abnormal WT + MO2-ret standard conditions Fig. 6 with image from Heanue et al., 2008
posterior lateral line primordium neuron projection absent, abnormal rw0130aTg; ump1Tg + MO2-ret standard conditions Fig. 2 with image from Schuster et al., 2010
posterior lateral line primordium neuron projection absent, abnormal zf106Tg; zf148Tg + MO2-ret standard conditions Fig. 2 with image from Schuster et al., 2010
enteric neuron decreased amount, abnormal WT + MO1-sema3c + MO2-ret standard conditions Fig. 3 from Jiang et al., 2015
gut innervation disrupted, abnormal WT + MO1-sema3c + MO2-ret standard conditions Fig. 3 from Jiang et al., 2015
gut innervation disrupted, abnormal WT + MO2-ret + MO3-sema3d standard conditions Fig. 3 from Jiang et al., 2015
enteric neuron decreased amount, abnormal WT + MO2-ret + MO3-sema3d standard conditions Fig. 3 from Jiang et al., 2015
enteric neuron decreased amount, abnormal WT + MO2-ret + MO4-rad21a standard conditions Fig. 3 from Bonora et al., 2015
enteric neuron decreased amount, abnormal w37Tg + CRISPR1-gnl1 + MO2-ret standard conditions Fig 5 with image from Kuil et al., 2021
enteric nervous system neuron migration arrested, abnormal w37Tg + CRISPR1-gnl1 + MO2-ret standard conditions Fig 5 with image from Kuil et al., 2021
enteric neuron decreased amount, abnormal w37Tg + CRISPR1-tubb5 + MO2-ret standard conditions Fig 3 with image from Kuil et al., 2021
enteric neuron decreased amount, exacerbated w37Tg + CRISPR2-mapk8a + CRISPR2-mapk8b + MO2-ret standard conditions Fig 3 with image from Kuil et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.