Morpholino

MO1-col15a1a

ID
ZDB-MRPHLNO-080918-3
Name
MO1-col15a1a
Previous Names
  • col15a1-MOA (1)
  • MO1-col15a1 (1)
  • MO1-col15a1l
Target
Sequence
5' - GAAACTCCTTCTGGACCCATGATGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-col15a1a
Expressed Gene Anatomy Figures
col2a1a Fig. 5 with image from Pagnon-Minot et al., 2008
col15a1a Fig. 3 with image from Pagnon-Minot et al., 2008
dmd Fig. 4 with image from Pagnon-Minot et al., 2008
ihhb Fig. 5 with image from Pagnon-Minot et al., 2008
ptch2 Fig. 10 with image from Pagnon-Minot et al., 2008
Phenotype
Phenotype resulting from MO1-col15a1a
Phenotype Fish Figures
fast muscle cell myofibril disorganized, abnormal WT + MO1-col15a1a Fig. 8 with image from Pagnon-Minot et al., 2008
fast muscle cell myofibril misaligned with fast muscle cell myofibril, abnormal WT + MO1-col15a1a Fig. 8 with image from Pagnon-Minot et al., 2008
horizontal myoseptum aplastic, abnormal WT + MO1-col15a1a Fig. 4 with image from Pagnon-Minot et al., 2008
muscle disorganized, abnormal WT + MO1-col15a1a Fig. 4 with image from Pagnon-Minot et al., 2008
muscle cell myofibril decreased amount, abnormal WT + MO1-col15a1a Fig. 6 with image from Pagnon-Minot et al., 2008
musculoskeletal movement arrested, abnormal WT + MO1-col15a1a Fig. 7 with image from Pagnon-Minot et al., 2008
myotome U-shaped, abnormal WT + MO1-col15a1a Fig. 4 with image from Pagnon-Minot et al., 2008
notochord basement membrane disorganized, abnormal WT + MO1-col15a1a Fig. 6 with image from Pagnon-Minot et al., 2008
notochord basement membrane distributed, abnormal WT + MO1-col15a1a Fig. 5 with image from Pagnon-Minot et al., 2008
notochord vacuole decreased size, abnormal WT + MO1-col15a1a Fig. 5 with image from Pagnon-Minot et al., 2008
perichordal connective tissue decreased thickness, abnormal WT + MO1-col15a1a Fig. 4 with image from Pagnon-Minot et al., 2008
perichordal connective tissue disorganized, abnormal WT + MO1-col15a1a Fig. 4 with image,  Fig. 6 with image from Pagnon-Minot et al., 2008
primary motor neuron axon decreased length, abnormal WT + MO1-col15a1a Fig. 11 with image from Pagnon-Minot et al., 2008
primary motor neuron axon shape, abnormal WT + MO1-col15a1a Fig. 11 with image from Pagnon-Minot et al., 2008
slow muscle cell myofibril disorganized, abnormal WT + MO1-col15a1a Fig. 8 with image from Pagnon-Minot et al., 2008
slow muscle cell myofibril misaligned with slow muscle cell myofibril, abnormal WT + MO1-col15a1a Fig. 8 with image from Pagnon-Minot et al., 2008
whole organism behavioural inactive, abnormal WT + MO1-col15a1a Fig. 7 with image from Pagnon-Minot et al., 2008
Phenotype of all Fish created by or utilizing MO1-col15a1a
Phenotype Fish Conditions Figures
fast muscle cell myofibril disorganized, abnormal WT + MO1-col15a1a standard conditions Fig. 8 with image from Pagnon-Minot et al., 2008
muscle disorganized, abnormal WT + MO1-col15a1a standard conditions Fig. 4 with image from Pagnon-Minot et al., 2008
myotome U-shaped, abnormal WT + MO1-col15a1a standard conditions Fig. 4 with image from Pagnon-Minot et al., 2008
musculoskeletal movement arrested, abnormal WT + MO1-col15a1a standard conditions Fig. 7 with image from Pagnon-Minot et al., 2008
slow muscle cell myofibril disorganized, abnormal WT + MO1-col15a1a standard conditions Fig. 8 with image from Pagnon-Minot et al., 2008
whole organism behavioural inactive, abnormal WT + MO1-col15a1a standard conditions Fig. 7 with image from Pagnon-Minot et al., 2008
muscle cell myofibril decreased amount, abnormal WT + MO1-col15a1a standard conditions Fig. 6 with image from Pagnon-Minot et al., 2008
perichordal connective tissue decreased thickness, abnormal WT + MO1-col15a1a standard conditions Fig. 4 with image from Pagnon-Minot et al., 2008
slow muscle cell myofibril misaligned with slow muscle cell myofibril, abnormal WT + MO1-col15a1a standard conditions Fig. 8 with image from Pagnon-Minot et al., 2008
primary motor neuron axon shape, abnormal WT + MO1-col15a1a standard conditions Fig. 11 with image from Pagnon-Minot et al., 2008
horizontal myoseptum aplastic, abnormal WT + MO1-col15a1a standard conditions Fig. 4 with image from Pagnon-Minot et al., 2008
notochord basement membrane disorganized, abnormal WT + MO1-col15a1a standard conditions Fig. 6 with image from Pagnon-Minot et al., 2008
fast muscle cell myofibril misaligned with fast muscle cell myofibril, abnormal WT + MO1-col15a1a standard conditions Fig. 8 with image from Pagnon-Minot et al., 2008
notochord vacuole decreased size, abnormal WT + MO1-col15a1a standard conditions Fig. 5 with image from Pagnon-Minot et al., 2008
primary motor neuron axon decreased length, abnormal WT + MO1-col15a1a standard conditions Fig. 11 with image from Pagnon-Minot et al., 2008
notochord basement membrane distributed, abnormal WT + MO1-col15a1a standard conditions Fig. 5 with image from Pagnon-Minot et al., 2008
perichordal connective tissue disorganized, abnormal WT + MO1-col15a1a standard conditions Fig. 4 with image,  Fig. 6 with image from Pagnon-Minot et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.