Morpholino

MO2-olfm2a

ID

ZDB-MRPHLNO-080725-8

Name

MO2-olfm2a

Previous Names

MO2-olfm2
OM2 3i4e MO (1)

Target

olfm2a (1)

Sequence

5' - CCTTTAACTCCTGCGGTAAACAGAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-olfm2a

Expressed Gene	Anatomy	Figures
pax2a	midbrain hindbrain boundary optic cup optic vesicle	Fig. 3 from Lee et al., 2008

Phenotype

Phenotype resulting from MO2-olfm2a

Phenotype	Fish	Figures
axon extension disrupted, abnormal	rw0Tg + MO2-olfm2a	Fig. 5 from Lee et al., 2008
cranial ganglion decreased size, abnormal	rw0Tg + MO2-olfm2a	Fig. 5 from Lee et al., 2008
cranial nerve morphology, abnormal	rw0Tg + MO2-olfm2a	Fig. 5 from Lee et al., 2008
eye decreased size, abnormal	WT + MO2-olfm2a	Fig. 3 , Fig. 4 from Lee et al., 2008
fourth ventricle edematous, abnormal	WT + MO2-olfm2a	Fig. 3 from Lee et al., 2008
midbrain hindbrain boundary decreased thickness, abnormal	WT + MO2-olfm2a	Fig. 3 from Lee et al., 2008
midbrain hindbrain boundary shape, abnormal	WT + MO2-olfm2a	Fig. 3 from Lee et al., 2008
motor neuron axon guidance disrupted, abnormal	rw0Tg + MO2-olfm2a	Fig. 5 from Lee et al., 2008
mouth malformed, abnormal	WT + MO2-olfm2a	Fig. 4 from Lee et al., 2008
neural crest cell development disrupted, abnormal	WT + MO2-olfm2a	Fig. 8 from Lee et al., 2008
neural crest cell migration disrupted, abnormal	WT + MO2-olfm2a	Fig. 8 from Lee et al., 2008
olfactory pit decreased size, abnormal	WT + MO2-olfm2a	Fig. 4 from Lee et al., 2008
optic tectum decreased size, abnormal	WT + MO2-olfm2a	Fig. 3 from Lee et al., 2008
oral cavity mislocalised posteriorly, abnormal	WT + MO2-olfm2a	Fig. 4 from Lee et al., 2008
pharyngeal arch aplastic, abnormal	WT + MO2-olfm2a	Fig. 4 from Lee et al., 2008
pharyngeal pouch morphology, abnormal	rw0Tg + MO2-olfm2a	Fig. 6 from Lee et al., 2008
rhombomere 6 cranial neural crest cell decreased amount, abnormal	WT + MO2-olfm2a	Fig. 8 from Lee et al., 2008
trigeminal motor nucleus fused with trigeminal motor nucleus, abnormal	rw0Tg + MO2-olfm2a	Fig. 5 from Lee et al., 2008

Phenotype of all Fish created by or utilizing MO2-olfm2a

Phenotype	Fish	Conditions	Figures
eye decreased size, abnormal	WT + MO2-olfm2a	standard conditions	Fig. 3 , Fig. 4 from Lee et al., 2008
optic tectum decreased size, abnormal	WT + MO2-olfm2a	standard conditions	Fig. 3 from Lee et al., 2008
midbrain hindbrain boundary shape, abnormal	WT + MO2-olfm2a	standard conditions	Fig. 3 from Lee et al., 2008
olfactory pit decreased size, abnormal	WT + MO2-olfm2a	standard conditions	Fig. 4 from Lee et al., 2008
fourth ventricle edematous, abnormal	WT + MO2-olfm2a	standard conditions	Fig. 3 from Lee et al., 2008
midbrain hindbrain boundary decreased thickness, abnormal	WT + MO2-olfm2a	standard conditions	Fig. 3 from Lee et al., 2008
pharyngeal arch aplastic, abnormal	WT + MO2-olfm2a	standard conditions	Fig. 4 from Lee et al., 2008
oral cavity mislocalised posteriorly, abnormal	WT + MO2-olfm2a	standard conditions	Fig. 4 from Lee et al., 2008
rhombomere 6 cranial neural crest cell decreased amount, abnormal	WT + MO2-olfm2a	standard conditions	Fig. 8 from Lee et al., 2008
mouth malformed, abnormal	WT + MO2-olfm2a	standard conditions	Fig. 4 from Lee et al., 2008
neural crest cell development disrupted, abnormal	WT + MO2-olfm2a	standard conditions	Fig. 8 from Lee et al., 2008
neural crest cell migration disrupted, abnormal	WT + MO2-olfm2a	standard conditions	Fig. 8 from Lee et al., 2008
cranial ganglion decreased size, abnormal	rw0Tg + MO2-olfm2a	standard conditions	Fig. 5 from Lee et al., 2008
pharyngeal pouch morphology, abnormal	rw0Tg + MO2-olfm2a	standard conditions	Fig. 6 from Lee et al., 2008
axon extension disrupted, abnormal	rw0Tg + MO2-olfm2a	standard conditions	Fig. 5 from Lee et al., 2008
cranial nerve morphology, abnormal	rw0Tg + MO2-olfm2a	standard conditions	Fig. 5 from Lee et al., 2008
motor neuron axon guidance disrupted, abnormal	rw0Tg + MO2-olfm2a	standard conditions	Fig. 5 from Lee et al., 2008
trigeminal motor nucleus fused with trigeminal motor nucleus, abnormal	rw0Tg + MO2-olfm2a	standard conditions	Fig. 5 from Lee et al., 2008

Citations