Community Action Needed: Please respond to the NIH RFI
Morpholino

MO2-cdh5

ID
ZDB-MRPHLNO-080506-1
Name
MO2-cdh5
Previous Names
  • MO4-cdh5
Target
Sequence
5' - TACAAGACCGTCTACCTTTCCAATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cdh5
Expressed Gene Anatomy Figures
cdh5 Fig. S1 from Anderson et al., 2015
Phenotype
Phenotype resulting from MO2-cdh5
Phenotype of all Fish created by or utilizing MO2-cdh5
Citations