Morpholino

MO1-klf6a

ID
ZDB-MRPHLNO-080208-5
Name
MO1-klf6a
Previous Names
  • KLF6a-atg (1)
  • MO1-copeb
Target
Sequence
5' - CACATTGGTAGAACATCCATTGCAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This morpholino targets the transcription start site.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-klf6a
Phenotype
Phenotype resulting from MO1-klf6a
Phenotype of all Fish created by or utilizing MO1-klf6a
Phenotype Fish Conditions Figures
intermediate cell mass of mesoderm posterior region ccl25b expression decreased amount, abnormal TU + MO1-klf6a standard conditions Fig. 5 with image from Xue et al., 2017
whole organism posterior region ccl25b expression decreased amount, abnormal TU + MO1-klf6a standard conditions Fig. 5 with image from Xue et al., 2017
caudal hematopoietic tissue hematopoietic stem cell proliferation decreased occurrence, abnormal TU + MO1-klf6a standard conditions Fig. 3 with image from Xue et al., 2017
erythrocyte maturation arrested, abnormal WT + MO1-klf6a standard conditions Fig. 5 with image from Xue et al., 2015
nucleate erythrocyte decreased amount, abnormal WT + MO1-klf6a standard conditions Fig. 5 with imageFig. 6 with image from Xue et al., 2015
primitive erythrocyte differentiation arrested, abnormal WT + MO1-klf6a standard conditions Fig. 5 with image from Xue et al., 2015
caudal hematopoietic tissue hematopoietic multipotent progenitor cell decreased amount, abnormal la2Tg + MO1-klf6a standard conditions Fig. 3 with image from Xue et al., 2017
blood island cell cycle process quality, abnormal sd2Tg + MO1-klf6a standard conditions Fig. 6 with image from Xue et al., 2015
blood island cell population proliferation decreased process quality, abnormal sd2Tg + MO1-klf6a standard conditions Fig. 6 with image from Xue et al., 2015
caudal vein plexus blood vessel endothelial cell migration decreased process quality, abnormal ci5Tg; y7Tg + MO1-klf6a standard conditions Fig 4 with image from Wen et al., 2021
caudal hematopoietic tissue hematopoietic stem cell decreased amount, abnormal ioz1Tg; s896Tg + MO1-klf6a standard conditions Fig. 3 with image from Xue et al., 2017
caudal hematopoietic tissue hematopoietic multipotent progenitor cell decreased amount, abnormal la2Tg; s896Tg + MO1-klf6a standard conditions Fig. 3 with image from Xue et al., 2017
caudal vein plexus cell-cell junction maintenance decreased process quality, abnormal cdh5cqu2Tg; cqu6Tg + MO1-klf6a standard conditions Fig 5 with image from Wen et al., 2021
caudal vein plexus actin cytoskeleton organization decreased process quality, abnormal cdh5cqu2Tg; cqu6Tg + MO1-klf6a standard conditions Fig 5 with image from Wen et al., 2021
caudal vein plexus blood vessel remodeling decreased process quality, abnormal cdh5cqu2Tg; cqu6Tg + MO1-klf6a standard conditions Fig 5 with image from Wen et al., 2021
Citations