Morpholino
MO1-prickle1b
- ID
- ZDB-MRPHLNO-071221-3
- Name
- MO1-prickle1b
- Previous Names
-
- Pk1b-MO-SA-I3E4 (1)
- Target
- Sequence
-
5' - GGCAGTAGCGAATCTGTGTTGAAGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice blocking morpholino against the intron3-exon4 boundary.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-prickle1b
No data available
Phenotype
Phenotype resulting from MO1-prickle1b
1 - 5 of 12 Show all
Phenotype of all Fish created by or utilizing MO1-prickle1b
1 - 5 of 42 Show all
Citations
- Beiriger, A., Narayan, S., Singh, N., Prince, V. (2020) Development and migration of the zebrafish rhombencephalic octavolateral efferent neurons. The Journal of comparative neurology. 529(7):1293-1307
- Ahsan, K., Singh, N., Rocha, M., Huang, C., Prince, V.E. (2019) Prickle1 is required for EMT and migration of zebrafish cranial neural crest. Developmental Biology. 448(1):16-35
- Mapp, O.M., Walsh, G.S., Moens, C.B., Tada, M., and Prince, V.E. (2011) Zebrafish Prickle1b mediates facial branchiomotor neuron migration via a farnesylation-dependent nuclear activity. Development (Cambridge, England). 138(10):2121-2132
- Walsh, G.S., Grant, P.K., Morgan, J.A., and Moens, C.B. (2011) Planar polarity pathway and Nance-Horan syndrome-like 1b have essential cell-autonomous functions in neuronal migration. Development (Cambridge, England). 138(14):3033-3042
- Zigman, M., Trinh, L.A., Fraser, S.E., and Moens, C.B. (2011) Zebrafish Neural Tube Morphogenesis Requires Scribble-Dependent Oriented Cell Divisions. Current biology : CB. 21(1):79-86
- Bingham, S.M., Sittaramane, V., Mapp, O., Patil, S., Prince, V.E., and Chandrasekhar, A. (2010) Multiple mechanisms mediate motor neuron migration in the zebrafish hindbrain. Developmental Neurobiology. 70(2):87-99
- Mapp, O.M., Wanner, S.J., Rohrschneider, M.R., and Prince, V.E. (2010) Prickle1b mediates interpretation of migratory cues during zebrafish facial branchiomotor neuron migration. Developmental Dynamics : an official publication of the American Association of Anatomists. 239(6):1596-1608
- Rohrschneider, M.R., Elsen, G.E., and Prince, V.E. (2007) Zebrafish Hoxb1a regulates multiple downstream genes including prickle1b. Developmental Biology. 309(2):358-372
1 - 8 of 8
Show