Morpholino

MO1-met

ID

ZDB-MRPHLNO-071219-1

Name

MO1-met

Previous Names

CM1 (1)
CM1a (1)
c-met AUG MO (1)

Target

met (1)

Sequence

5' - ATAGTGAATTGTCATCTTTGTTCCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-met

Expressed Gene	Anatomy	Figures
alcama	bile ductule	Fig. 4 from Anderson et al., 2013
cp	liver	Fig. 4 from Latimer et al., 2008
foxa3	endodermal cell gut liver	Fig. 2 , Fig. 4 from Latimer et al., 2008
hhex	liver primordium	Fig. 4 from Latimer et al., 2008
myod1	pectoral fin	Fig. 2 from Latimer et al., 2008
pax2a	pronephric duct pronephric proximal convoluted tubule pronephric tubule	Fig. 4 from Latimer et al., 2008
prox1a	extrapancreatic duct hepatocyte liver pancreatic ductal cell	Fig. 4 from Anderson et al., 2013

Phenotype

Phenotype resulting from MO1-met

Phenotype	Fish	Figures
exocrine pancreas development disrupted, abnormal	ia3Tg + MO1-met	Fig. 4 from Anderson et al., 2013
liver decreased size, abnormal	AB + MO1-met	Fig. 4 from Latimer et al., 2008
liver development disrupted, abnormal	AB + MO1-met	Fig. 4 from Latimer et al., 2008
pancreas spheroid, abnormal	ia3Tg + MO1-met	Fig. 1 , Fig. 4 from Anderson et al., 2013
pancreatic duct morphology, abnormal	ia3Tg + MO1-met	Fig. 4 from Anderson et al., 2013
pancreatic duct cell migration disrupted, abnormal	jh1Tg; m1018Tg + MO1-met	Fig. 4 from Anderson et al., 2013
pancreatic ductal cell located in hepatic duct, abnormal	jh1Tg; m1018Tg + MO1-met	Fig. 4 from Anderson et al., 2013
pectoral fin morphology, abnormal	AB + MO1-met	Fig. 2 from Latimer et al., 2008
pectoral fin musculature decreased tonicity, abnormal	ia3Tg + MO1-met	Fig. 4 from Anderson et al., 2013
whole organism curved ventral, abnormal	AB + MO1-met	Fig. 4 from Latimer et al., 2008

Phenotype of all Fish created by or utilizing MO1-met

Phenotype	Fish	Conditions	Figures
liver development disrupted, abnormal	AB + MO1-met	standard conditions	Fig. 4 from Latimer et al., 2008
liver decreased size, abnormal	AB + MO1-met	standard conditions	Fig. 4 from Latimer et al., 2008
whole organism curved ventral, abnormal	AB + MO1-met	standard conditions	Fig. 4 from Latimer et al., 2008
pectoral fin morphology, abnormal	AB + MO1-met	standard conditions	Fig. 2 from Latimer et al., 2008
musculoskeletal movement, spinal reflex action decreased rate, abnormal	WT + MO1-met + MO2-met	standard conditions	Fig. 3 from Tallafuss et al., 2008
CaP motoneuron neurotransmitter mislocalised, abnormal	WT + MO1-met + MO2-met	standard conditions	Fig. 8 from Tallafuss et al., 2008
motor neuron axon decreased length, abnormal	WT + MO1-met + MO2-met	standard conditions	Fig. 5 from Tallafuss et al., 2008
cerebellum apoptotic process increased occurrence, abnormal	WT + MO1-met + MO2-met	standard conditions	Fig. 9 from Tsai et al., 2015
CaP motoneuron obsolete cellular biosynthetic process disrupted, abnormal	WT + MO1-met + MO2-met	standard conditions	Fig. 8 from Tallafuss et al., 2008
CaP motoneuron axon decreased length, abnormal	WT + MO1-met + MO2-met	standard conditions	Fig. 4 , Fig. 5 from Tallafuss et al., 2008
cerebellum morphogenesis disrupted, abnormal	WT + MO1-met + MO6-met	standard conditions	Fig. 3 from Elsen et al., 2009
cerebellum cerebellar granule cell decreased amount, abnormal	WT + MO1-met + MO6-met	standard conditions	Fig. 4 from Elsen et al., 2009
central nervous system neuron differentiation disrupted, abnormal	WT + MO1-met + MO6-met	standard conditions	Fig. 3 from Elsen et al., 2009
cell proliferation in midbrain decreased rate, abnormal	WT + MO1-met + MO6-met	standard conditions	Fig. 5 from Elsen et al., 2009
cerebellum development disrupted, abnormal	WT + MO1-met + MO6-met	standard conditions	Fig. 3 from Elsen et al., 2009
cell proliferation in hindbrain decreased rate, abnormal	WT + MO1-met + MO6-met	standard conditions	Fig. 5 from Elsen et al., 2009
cerebellar granule cell differentiation disrupted, abnormal	WT + MO1-met + MO6-met	standard conditions	Fig. 4 from Elsen et al., 2009
pancreas spheroid, abnormal	ia3Tg + MO1-met	standard conditions	Fig. 4 from Anderson et al., 2013
pectoral fin musculature decreased tonicity, abnormal	ia3Tg + MO1-met	standard conditions	Fig. 4 from Anderson et al., 2013
pancreatic duct morphology, abnormal	ia3Tg + MO1-met	standard conditions	Fig. 4 from Anderson et al., 2013
exocrine pancreas development disrupted, abnormal	ia3Tg + MO1-met	standard conditions	Fig. 4 from Anderson et al., 2013
pancreatic duct cell migration disrupted, abnormal	ia3Tg + MO1-met	standard conditions	Fig. 4 from Anderson et al., 2013
pancreatic ductal cell located in hepatic duct, abnormal	ia3Tg + MO1-met	standard conditions	Fig. 4 from Anderson et al., 2013
cerebellum development disrupted, abnormal	knu3Tg + MO1-met + MO6-met	standard conditions	Fig. 2 from Elsen et al., 2009
cerebellum morphogenesis disrupted, abnormal	knu3Tg + MO1-met + MO6-met	standard conditions	Fig. 2 from Elsen et al., 2009
cerebellum neuron decreased amount, abnormal	knu3Tg + MO1-met + MO6-met	standard conditions	Fig. 2 from Elsen et al., 2009
central nervous system neuron differentiation disrupted, abnormal	knu3Tg + MO1-met + MO6-met	standard conditions	Fig. 2 from Elsen et al., 2009
neuron migration disrupted, abnormal	rw0Tg + MO1-met + MO6-met	standard conditions	Fig. 7 from Elsen et al., 2009
floor plate secondary motor neuron decreased amount, abnormal	zf35Tg + MO1-met + MO2-met	standard conditions	Fig. 6 from Tallafuss et al., 2008
pancreas spheroid, abnormal	gz15Tg; jh1Tg; m1018Tg + MO1-met	standard conditions	Fig. 1 from Anderson et al., 2013
pancreatic duct cell migration disrupted, abnormal	jh1Tg; m1018Tg + MO1-met	standard conditions	Fig. 4 from Anderson et al., 2013
pancreatic duct morphology, abnormal	jh1Tg; m1018Tg + MO1-met	standard conditions	Fig. 4 from Anderson et al., 2013
pancreatic ductal cell located in hepatic duct, abnormal	jh1Tg; m1018Tg + MO1-met	standard conditions	Fig. 4 from Anderson et al., 2013
pancreas spheroid, abnormal	jh1Tg; m1018Tg + MO1-met	standard conditions	Fig. 4 from Anderson et al., 2013
CaP motoneuron axon misrouted, abnormal	parga^mn2Et + MO1-met + MO2-met	standard conditions	Fig. 9 from Tallafuss et al., 2008
CaP motoneuron axon increased amount, abnormal	parga^mn2Et + MO1-met + MO2-met	standard conditions	Fig. 9 from Tallafuss et al., 2008

Citations