Community Action Needed: Please respond to the NIH RFI
Morpholino

MO3-spi1b

ID
ZDB-MRPHLNO-071203-2
Name
MO3-spi1b
Previous Names
  • MO3-spi1
Target
Sequence
5' - GGTCTTTCTCCTTACCATGCTCTCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splice-blocker targeted to exon 4-5 boundary
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-spi1b
Phenotype
Phenotype resulting from MO3-spi1b
Phenotype of all Fish created by or utilizing MO3-spi1b
Phenotype Fish Conditions Figures
whole organism decreased life span, abnormal slc24a5b1/b1 + MO2-spi1b + MO3-spi1b bacterial treatment: Mycobacteroides abscessus Fig. 6 with image from Halloum et al., 2016
whole organism decreased life span, ameliorated AB + MO3-spi1b bacterial treatment by injection: Burkholderia cenocepacia Fig. 1 with image from Mesureur et al., 2017
defense response to bacterium disrupted, abnormal WIK + MO2-spi1b + MO3-spi1b bacterial treatment: Mycobacterium marinum Fig. 3 from Clay et al., 2007
whole organism lacks all parts of type macrophage, abnormal WIK + MO2-spi1b + MO3-spi1b bacterial treatment: Mycobacterium marinum Fig. 5 from Clay et al., 2007
defense response to bacterium decreased occurrence, abnormal WIK + MO2-spi1b + MO3-spi1b bacterial treatment: Mycobacterium marinum Fig. 1 with imageFig. 6 with image from Clay et al., 2008
macrophage absent, abnormal WIK + MO2-spi1b + MO3-spi1b bacterial treatment: Mycobacterium marinum Fig. 6 with image from Clay et al., 2008
defense response to bacterium disrupted, abnormal WIK + MO2-spi1b + MO3-spi1b bacterial treatment: Mycobacterium marinum Fig. 4 from Clay et al., 2007
defense response to bacterium disrupted, abnormal WIK + MO2-spi1b + MO3-spi1b bacterial treatment: Mycobacterium marinum Fig. 5 from Clay et al., 2007
whole organism lacks all parts of type macrophage, abnormal WIK + MO2-spi1b + MO3-spi1b bacterial treatment: Mycobacterium marinum text only from Clay et al., 2007
whole organism viability, abnormal WT + MO2-spi1b + MO3-spi1b bacterial treatment: Streptococcus pneumoniae TIGR4 Fig. 5 from Rounioja et al., 2012
whole organism decreased life span, abnormal WT + MO2-spi1b + MO3-spi1b bacterial treatment: Streptococcus pneumoniae TIGR4 Fig. 5 from Rounioja et al., 2012
myeloid cell decreased amount, abnormal WT + MO3-spi1b standard conditions Fig. 4 from Su et al., 2007
macrophage differentiation disrupted, abnormal WT + MO3-spi1b standard conditions Fig. 4 from Su et al., 2007
granuloma formation increased occurrence, abnormal i114Tg + MO2-spi1b + MO3-spi1b bacterial treatment: Mycobacteroides abscessus Fig. 7 with image from Halloum et al., 2016
whole organism decreased life span, exacerbated ump2Tg + MO2-spi1b + MO3-spi1b bacterial treatment by injection: Mycobacteroides abscessus Fig. 5 from Bernut et al., 2015
macrophage absent, abnormal ump2Tg + MO2-spi1b + MO3-spi1b control Fig. 5 from Bernut et al., 2015
macrophage mCherry expression absent, abnormal ump2Tg + MO2-spi1b + MO3-spi1b control Fig. 5 from Bernut et al., 2015
macrophage mCherry expression absent, abnormal ump2Tg + MO3-spi1b bacterial treatment by injection: Burkholderia cenocepacia Fig. 1 with image from Mesureur et al., 2017
macrophage absent, abnormal ump2Tg + MO3-spi1b bacterial treatment by injection: Burkholderia cenocepacia Fig. 1 with image from Mesureur et al., 2017
macrophage decreased amount, abnormal ump2Tg + MO3-spi1b bacterial treatment by injection: Burkholderia cenocepacia Fig. 1 with image from Mesureur et al., 2017
defense response to bacterium disrupted, abnormal y1Tg + MO2-spi1b + MO3-spi1b bacterial treatment: Mycobacterium marinum Fig. 6 from Clay et al., 2007
Citations