header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-071107-2
Morpholino Name: MO3-wt1a
Target: wt1a (1)
Previous Name: wt1a-AUG (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CACGAACATCAGAACCCATTTTGAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-wt1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-wt1a
Expressed Gene Anatomy Figures
cdh17 Fig. 3 with image from O'Brien et al., 2011
hey1 Fig. 3 with image from O'Brien et al., 2011
nphs1 Fig. 3 with image from O'Brien et al., 2011
nr5a1a Fig. 3 with image from O'Brien et al., 2011
pax2a Fig. 3 with image from O'Brien et al., 2011
podxl Fig. 3 with image from O'Brien et al., 2011
slc20a1a Fig. 3 with image from O'Brien et al., 2011
wt1b Fig. 3 with image from O'Brien et al., 2011
PHENOTYPE
Phenotype resulting from MO3-wt1a
Phenotype of all Fish created by or utilizing MO3-wt1a
Phenotype Fish Conditions Figures
yolk edematous, abnormal AB/TU + MO3-wt1a standard conditions Fig. S1 with image from Perner et al., 2007
pericardium edematous, abnormal AB/TU + MO3-wt1a standard conditions Fig. S1 with image from Perner et al., 2007
interrenal primordium increased size, abnormal TU + MO3-wt1a standard conditions Fig. 3 with image from O'Brien et al., 2011
pronephric podocyte decreased amount, abnormal TU + MO3-wt1a standard conditions Fig. 3 with image from O'Brien et al., 2011
pronephric podocyte decreased amount, abnormal TU + MO1-foxc1a + MO3-wt1a standard conditions Fig. 3 with image from O'Brien et al., 2011
interrenal primordium absent, abnormal TU + MO1-foxc1a + MO3-wt1a standard conditions Fig. 3 with image from O'Brien et al., 2011
pronephric tubule absent, abnormal TU + MO1-foxc1a + MO3-wt1a standard conditions Fig. 3 with image from O'Brien et al., 2011
pronephric podocyte decreased amount, abnormal TU + MO3-wt1a + MO4-rbpja,rbpjb standard conditions Fig. 3 with image from O'Brien et al., 2011
pronephric tubule absent, abnormal TU + MO3-wt1a + MO4-rbpja,rbpjb standard conditions Fig. 3 with image from O'Brien et al., 2011
interrenal primordium increased size, abnormal TU + MO3-wt1a + MO4-rbpja,rbpjb standard conditions Fig. 3 with image from O'Brien et al., 2011
pronephros lacks all parts of type pronephric podocyte, abnormal hnf1bahi1843Tg/hi1843Tg + MO1-hnf1bb + MO3-wt1a + MO4-rbpja,rbpjb standard conditions Fig. 4 from Naylor et al., 2013
glomerular visceral epithelial cell differentiation decreased occurrence, abnormal hnf1bahi1843Tg/hi1843Tg + MO1-hnf1bb + MO3-wt1a + MO4-rbpja,rbpjb standard conditions Fig. 4 from Naylor et al., 2013
Genome Resources:
CITATIONS (3)