Morpholino
MO1-loxl5b
- ID
- ZDB-MRPHLNO-070919-4
- Name
- MO1-loxl5b
- Previous Names
- None
- Target
- Sequence
-
5' - GCCTGTGGAATAAACACCAGCCTCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-loxl5b
No data available
Phenotype
Phenotype resulting from MO1-loxl5b
Phenotype | Fish | Figures |
---|---|---|
caudal vein edematous, abnormal | WT + MO1-loxl5b |
Fig. 5 ![]() |
notochord kinked, abnormal | WT + MO1-loxl5b |
Fig. 5 ![]() |
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-loxl5b
1 - 5 of 14 Show all
Citations
- van Boxtel, A.L., Kamstra, J.H., Fluitsma, D.M., and Legler, J. (2010) Dithiocarbamates are teratogenic to developing zebrafish through inhibition of lysyl oxidase activity. Toxicology and applied pharmacology. 244(2):156-161
- Gansner, J.M., Madsen, E.C., Mecham, R.P., and Gitlin, J.D. (2008) Essential role for fibrillin-2 in zebrafish notochord and vascular morphogenesis. Developmental Dynamics : an official publication of the American Association of Anatomists. 237(10):2844-2861
- Gansner, J.M., Mendelsohn, B.A., Hultman, K.A., Johnson, S.L., and Gitlin, J.D. (2007) Essential role of lysyl oxidases in notochord development. Developmental Biology. 307(2):202-213
1 - 3 of 3
Show