ZFIN ID: ZDB-MRPHLNO-070730-7
Morpholino Name: MO4-mib1
Target: mib1 (1)
Sequence:
5' - TGCGATTTAAGTTACTTTTAGCTGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: binds 5'UTR
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-mib1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-mib1
Expressed Gene Anatomy Figures
dlc Fig. 2 with image from Zhang et al., 2007
elavl3 Fig. 2 with image from Zhang et al., 2007
her4.1 Fig. 2 with image from Zhang et al., 2007
PHENOTYPE
Phenotype resulting from MO4-mib1
Phenotype Figures
post-vent region increased curvature, abnormal Fig. 2 with image from Zhang et al., 2007
post-vent region melanocyte decreased amount, abnormal Fig. 2 with imageTable 2 with image from Zhang et al., 2007
ventral wall of dorsal aorta has fewer parts of type hematopoietic stem cell, abnormal Fig. S4 with image from Sawamiphak et al., 2014

Phenotype of all Fish created by or utilizing MO4-mib1
Phenotype Fish Conditions Figures
post-vent region melanocyte decreased amount, abnormal mib1m132/m132 + MO4-mib1 standard conditions Fig. 2 with imageTable 2 with image from Zhang et al., 2007
post-vent region increased curvature, abnormal mib1m132/m132 + MO4-mib1 standard conditions Fig. 2 with image from Zhang et al., 2007
post-vent region melanocyte decreased amount, abnormal mib1ta52b/ta52b + MO4-mib1 standard conditions Fig. 2 with imageTable 2 with image from Zhang et al., 2007
post-vent region increased curvature, abnormal mib1ta52b/ta52b + MO4-mib1 standard conditions Fig. 2 with image from Zhang et al., 2007
ventral wall of dorsal aorta has fewer parts of type hematopoietic stem cell, abnormal la2Tg; s896Tg + MO4-mib1 standard conditions Fig. S4 with image from Sawamiphak et al., 2014
OTHER MO4-mib1 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)