header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070730-7
Morpholino Name: MO4-mib1
Target: mib1 (1)
Sequence:
5' - TGCGATTTAAGTTACTTTTAGCTGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: binds 5'UTR
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-mib1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-mib1
Expressed Gene Anatomy Figures
dlc Fig. 2 with image from Zhang et al., 2007
elavl3 Fig. 2 with image from Zhang et al., 2007
her4.1 Fig. 2 with image from Zhang et al., 2007
PHENOTYPE
Phenotype resulting from MO4-mib1
Phenotype of all Fish created by or utilizing MO4-mib1
OTHER MO4-mib1 MORPHOLINO PAGES No links to external sites
CITATIONS (2)